ID: 943502016

View in Genome Browser
Species Human (GRCh38)
Location 2:188703391-188703413
Sequence TCATCTACCAGTACACTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943502012_943502016 -4 Left 943502012 2:188703372-188703394 CCCACCCTATTCTTATAATTCAT No data
Right 943502016 2:188703391-188703413 TCATCTACCAGTACACTCTCAGG No data
943502011_943502016 -3 Left 943502011 2:188703371-188703393 CCCCACCCTATTCTTATAATTCA No data
Right 943502016 2:188703391-188703413 TCATCTACCAGTACACTCTCAGG No data
943502014_943502016 -8 Left 943502014 2:188703376-188703398 CCCTATTCTTATAATTCATCTAC No data
Right 943502016 2:188703391-188703413 TCATCTACCAGTACACTCTCAGG No data
943502010_943502016 -2 Left 943502010 2:188703370-188703392 CCCCCACCCTATTCTTATAATTC No data
Right 943502016 2:188703391-188703413 TCATCTACCAGTACACTCTCAGG No data
943502015_943502016 -9 Left 943502015 2:188703377-188703399 CCTATTCTTATAATTCATCTACC No data
Right 943502016 2:188703391-188703413 TCATCTACCAGTACACTCTCAGG No data
943502013_943502016 -5 Left 943502013 2:188703373-188703395 CCACCCTATTCTTATAATTCATC No data
Right 943502016 2:188703391-188703413 TCATCTACCAGTACACTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943502016 Original CRISPR TCATCTACCAGTACACTCTC AGG Intergenic
No off target data available for this crispr