ID: 943502862

View in Genome Browser
Species Human (GRCh38)
Location 2:188713460-188713482
Sequence TAGAAAAAAACAACCACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943502860_943502862 9 Left 943502860 2:188713428-188713450 CCCTTTATTTTCTGATAAGTAGT No data
Right 943502862 2:188713460-188713482 TAGAAAAAAACAACCACTGATGG No data
943502859_943502862 10 Left 943502859 2:188713427-188713449 CCCCTTTATTTTCTGATAAGTAG No data
Right 943502862 2:188713460-188713482 TAGAAAAAAACAACCACTGATGG No data
943502861_943502862 8 Left 943502861 2:188713429-188713451 CCTTTATTTTCTGATAAGTAGTG No data
Right 943502862 2:188713460-188713482 TAGAAAAAAACAACCACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943502862 Original CRISPR TAGAAAAAAACAACCACTGA TGG Intergenic
No off target data available for this crispr