ID: 943508244

View in Genome Browser
Species Human (GRCh38)
Location 2:188789977-188789999
Sequence TTAGCTTAACAACTGATGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943508244 Original CRISPR TTAGCTTAACAACTGATGCA GGG Exonic
909277948 1:73712400-73712422 TTACCTTTACTACTGATGAAGGG + Intergenic
911091282 1:94019346-94019368 GCAGCTTAACAACTGGTGAACGG - Intronic
916527378 1:165623774-165623796 TTATCATAAAAACTGATTCAAGG - Intergenic
917858960 1:179126861-179126883 TTAGCTTAACCACAGAAGTATGG + Intronic
918743689 1:188170598-188170620 TTACCTTTACAACAGCTGCATGG + Intergenic
922538979 1:226404735-226404757 TTAGCTGCACAGCTGAGGCAAGG + Intronic
923245594 1:232128833-232128855 CTACCTGAAGAACTGATGCAAGG - Intergenic
1065451595 10:25864345-25864367 TGAGCTGAACAACTGAGGTAGGG + Intergenic
1068454414 10:57236623-57236645 TTAGCTTAACAAGAGAATCATGG + Intergenic
1074650212 10:115513979-115514001 CTTTCTTAAAAACTGATGCAAGG - Intronic
1075827182 10:125369095-125369117 TTAGCTTAGCAACTGTAGTATGG + Intergenic
1087417914 11:97882366-97882388 TTAGCTTAAAAACTGAATTAGGG + Intergenic
1090684888 11:129105029-129105051 CTACCTGAAGAACTGATGCAAGG + Intronic
1093116314 12:15215948-15215970 TTATTTTAACAAATGATACAAGG + Intronic
1096023479 12:48341514-48341536 TTAGCTTTTCAGCTGCTGCAGGG - Exonic
1099149124 12:79086825-79086847 TAAGCTGAAAAACTAATGCATGG + Intronic
1104041035 12:125131085-125131107 TTACCTTAAAAAATGATGCCAGG + Intronic
1105280429 13:18959849-18959871 TTAGCTTCTGAACTGATGCCAGG + Intergenic
1108784256 13:53875233-53875255 TTAGTTTAGCAACTGATACATGG - Intergenic
1109004393 13:56852871-56852893 TTTGCTTAAAATGTGATGCATGG - Intergenic
1109119551 13:58437276-58437298 TTAGCTTTACAGCTGAGGAAAGG + Intergenic
1109939963 13:69348742-69348764 TTGACTTGACAACTGATGAATGG + Intergenic
1110150071 13:72240661-72240683 TTAGCATAATGACTGATCCATGG + Intergenic
1117225644 14:53655787-53655809 ATAGCTGAACAATTTATGCAGGG + Intergenic
1117762588 14:59046686-59046708 TTTGCCTCACAGCTGATGCAAGG + Intergenic
1119970931 14:78969501-78969523 GTAAATTAACAACTGATACAAGG - Intronic
1119991892 14:79207478-79207500 TCATATTAACAACTGGTGCAAGG + Intronic
1127309903 15:57743440-57743462 TGTGATTAACAACTGTTGCAGGG + Intronic
1127580694 15:60336921-60336943 TTAGTTTAAAAAATGATGCCGGG + Intergenic
1128567958 15:68713764-68713786 TTAGCTTAACCACATCTGCAAGG + Intronic
1134115439 16:11544342-11544364 TTAGACAAACAACTAATGCAGGG + Intergenic
1147473066 17:40682531-40682553 TTAGCTCAACAAACGATGAAGGG + Intergenic
1149214921 17:54343314-54343336 TTAGCATAAAAATAGATGCATGG + Intergenic
1149215201 17:54346350-54346372 TTAGCATAAAAATAGATGCATGG + Intergenic
1157699698 18:49753344-49753366 CTAACTTAACAACTGAGTCATGG + Intergenic
1158035156 18:53019721-53019743 TTATTTTAAAAAATGATGCATGG - Intronic
1160060553 18:75525517-75525539 TTAACTTAACAACTGCTTTAAGG + Intergenic
1164477064 19:28583889-28583911 TTAGCACAACATCTGGTGCACGG - Intergenic
1164848375 19:31456007-31456029 TTTTTTTAACTACTGATGCATGG - Intergenic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1167978085 19:53248471-53248493 TTTGCTTAACATTTCATGCAGGG + Intronic
925946974 2:8874281-8874303 TGAGAATAACAACTGCTGCAAGG - Intronic
928635837 2:33245618-33245640 TTACCTTTGAAACTGATGCAAGG + Intronic
929364468 2:41136369-41136391 TAAGATTAACTACTGATGTAAGG - Intergenic
930261841 2:49155698-49155720 TTTGTTCAACAACTGATCCAAGG + Intergenic
933705933 2:85290274-85290296 TTAGCTTAAAAACTGGGGCCGGG - Intronic
939054627 2:137349541-137349563 TTACCTTAAAAACTTATGCCAGG + Intronic
940805269 2:158180252-158180274 TTAGCACAAGACCTGATGCAGGG - Intronic
941259383 2:163277490-163277512 TTATTTTAATAAGTGATGCAAGG - Intergenic
941362691 2:164572072-164572094 TTACCAAAACAGCTGATGCAGGG + Intronic
941375472 2:164723722-164723744 TTATTTTAAAAACTGATGAAAGG + Intronic
942050610 2:172137182-172137204 TTAGCCTAACATCTAATGAAGGG + Intergenic
943508244 2:188789977-188789999 TTAGCTTAACAACTGATGCAGGG + Exonic
943580379 2:189676842-189676864 TTAGCTTCTAAACTGATGGAAGG - Exonic
947193596 2:227538486-227538508 TTCACTTAAGAACTGATGAATGG + Intronic
1171055815 20:21904942-21904964 TTAGTTTAGGAAGTGATGCAGGG - Intergenic
1177900688 21:26911586-26911608 GGAACTTAACATCTGATGCAGGG - Intergenic
951496698 3:23336563-23336585 TTGGCTTAAGGACTAATGCAAGG - Intronic
952938107 3:38416947-38416969 TTTGCATAACAAATTATGCAAGG + Intronic
953456180 3:43044158-43044180 TTTGCTTCACACCTGCTGCATGG - Intronic
965241725 3:166209479-166209501 CTAGCTAAAAAACTGATGCAAGG + Intergenic
965922620 3:173936757-173936779 TCAGGTGAAAAACTGATGCAAGG - Intronic
966872533 3:184300189-184300211 TTAACTTAACAACTCCTCCAAGG - Intronic
967730043 3:192899080-192899102 TTACCTTAACATATAATGCAAGG + Intronic
969894355 4:10289438-10289460 TTATCTTCCCAACTGATGAATGG - Intergenic
969898262 4:10324823-10324845 AAAGCTTAACCACTCATGCAGGG + Intergenic
974714422 4:65648870-65648892 GTAGTTTGACAACTGCTGCAGGG + Intronic
975964009 4:79947190-79947212 CTAGCTTAAAAACTGATAAATGG - Intronic
976292676 4:83436950-83436972 GTGGCTTAACAAGTGATGAAAGG - Exonic
976894616 4:90094132-90094154 TTAGATTAACAGCAGATGTATGG + Intergenic
979596003 4:122534634-122534656 TTGTCTTAACAACTGTTTCAGGG + Intergenic
980481056 4:133387811-133387833 TTCACTTAACAACAGATGTATGG + Intergenic
983119048 4:163857954-163857976 TTAACTTAGCATCAGATGCAGGG + Intronic
986859872 5:11914363-11914385 TTAGCTTGACCACTGATTCAAGG - Intergenic
987427536 5:17790513-17790535 TTAGCTTAACAATTACTGTAGGG - Intergenic
993782488 5:92085080-92085102 TTAACTTAACAAATAATGAAAGG + Intergenic
993987264 5:94612039-94612061 TTAGCTAAACAACTGATTTTTGG - Intronic
997609065 5:135199043-135199065 TTAGCAAAACAGCTGATGCCAGG - Intronic
1002374600 5:178779410-178779432 TTACCTTAAAAAATGATGCCAGG - Intergenic
1003288280 6:4754214-4754236 TTTGCTTAAAGACTGATTCAAGG - Intronic
1004369790 6:15042362-15042384 CTAGCTTAAAAACTAATGCCTGG + Intergenic
1004870973 6:19903540-19903562 TTGGCCTCACAATTGATGCAGGG - Intergenic
1005266804 6:24120688-24120710 TTGGCTGCAGAACTGATGCAGGG - Intergenic
1012030492 6:94054306-94054328 TTATTTTTACAAATGATGCATGG - Intergenic
1016647792 6:146429891-146429913 ATAGCTTCACAACAGATACAAGG - Intronic
1017225122 6:152012428-152012450 TTAGCATCACAGCTGGTGCAGGG - Intronic
1018019157 6:159742050-159742072 TTATCGTAACAACTAATGTATGG + Intronic
1028274695 7:88840242-88840264 TTAGATGAACAACTGATTGAAGG - Intronic
1028658734 7:93241578-93241600 ATAGCATAACAAATGATGGAGGG + Intronic
1034034526 7:147804852-147804874 TGAGGTTAAAAACTGAAGCAGGG - Intronic
1037981865 8:23260036-23260058 TTAGCTTTACAAAAGATGCCAGG - Intronic
1043758831 8:84038665-84038687 TTGGCTTAACAACTGACACATGG - Intergenic
1044833396 8:96272390-96272412 TGAAATTAACAACTGTTGCATGG - Intronic
1046218832 8:111185743-111185765 AAACCTTAACAACTGAGGCATGG + Intergenic
1046408931 8:113813528-113813550 TTATCTTAACAAATGCTGCTTGG - Intergenic
1047859479 8:128948826-128948848 TTAGCTTAACAGATGAACCATGG - Intergenic
1051918487 9:22235680-22235702 TTAGCTTAACAATACATGTATGG + Intergenic
1055868973 9:80851208-80851230 TTAGCTTGACTACTAAGGCATGG - Intergenic
1057928613 9:99173995-99174017 TTTGATTATGAACTGATGCAAGG + Intergenic
1059636168 9:116172906-116172928 TTAGCTTGAGATCTGATACATGG - Intronic
1060564247 9:124575673-124575695 ATAGCTGAAGAACTGAGGCATGG - Intronic
1061158673 9:128880841-128880863 TTGGCTTAACACGTGATGGATGG + Intronic
1190201206 X:48362838-48362860 TCTGCTTAACAAATGATGCTGGG - Intergenic
1193024391 X:76829618-76829640 CTAGCTGAAGGACTGATGCAAGG - Intergenic
1194647521 X:96475509-96475531 TTAGCTTACCAACTGGGGCTGGG - Intergenic
1195954248 X:110312355-110312377 TTAGAAAAACAACTCATGCATGG + Intronic
1197394735 X:125912617-125912639 TTAGCTCAAAAACTGATAAAGGG - Intergenic