ID: 943514018

View in Genome Browser
Species Human (GRCh38)
Location 2:188862501-188862523
Sequence ACCAGGTCGCTTAGGGTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943514018_943514024 -9 Left 943514018 2:188862501-188862523 CCTAAGACCCTAAGCGACCTGGT No data
Right 943514024 2:188862515-188862537 CGACCTGGTCCAGGAAAGGGTGG No data
943514018_943514027 13 Left 943514018 2:188862501-188862523 CCTAAGACCCTAAGCGACCTGGT No data
Right 943514027 2:188862537-188862559 GCAGCCATCTCTACAGCTCCAGG No data
943514018_943514028 16 Left 943514018 2:188862501-188862523 CCTAAGACCCTAAGCGACCTGGT No data
Right 943514028 2:188862540-188862562 GCCATCTCTACAGCTCCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943514018 Original CRISPR ACCAGGTCGCTTAGGGTCTT AGG (reversed) Intergenic
No off target data available for this crispr