ID: 943515508

View in Genome Browser
Species Human (GRCh38)
Location 2:188881022-188881044
Sequence CTGTTAACTCTGAGGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943515504_943515508 -10 Left 943515504 2:188881009-188881031 CCAACTAATACAACTGTTAACTC No data
Right 943515508 2:188881022-188881044 CTGTTAACTCTGAGGGATGAGGG No data
943515503_943515508 -5 Left 943515503 2:188881004-188881026 CCTAGCCAACTAATACAACTGTT No data
Right 943515508 2:188881022-188881044 CTGTTAACTCTGAGGGATGAGGG No data
943515500_943515508 24 Left 943515500 2:188880975-188880997 CCCATTCTGTGGTATTTTGTTAT 0: 16
1: 364
2: 1770
3: 4011
4: 6970
Right 943515508 2:188881022-188881044 CTGTTAACTCTGAGGGATGAGGG No data
943515501_943515508 23 Left 943515501 2:188880976-188880998 CCATTCTGTGGTATTTTGTTATA No data
Right 943515508 2:188881022-188881044 CTGTTAACTCTGAGGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943515508 Original CRISPR CTGTTAACTCTGAGGGATGA GGG Intergenic
No off target data available for this crispr