ID: 943517597

View in Genome Browser
Species Human (GRCh38)
Location 2:188907233-188907255
Sequence GACATCTCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943517597_943517602 16 Left 943517597 2:188907233-188907255 CCAGTAACAGGCCAAGAGATGTC No data
Right 943517602 2:188907272-188907294 GTTATCTGCAGAAGATGGCAGGG 0: 180
1: 172
2: 120
3: 86
4: 284
943517597_943517600 11 Left 943517597 2:188907233-188907255 CCAGTAACAGGCCAAGAGATGTC No data
Right 943517600 2:188907267-188907289 AGCTAGTTATCTGCAGAAGATGG No data
943517597_943517601 15 Left 943517597 2:188907233-188907255 CCAGTAACAGGCCAAGAGATGTC No data
Right 943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG 0: 185
1: 187
2: 104
3: 111
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943517597 Original CRISPR GACATCTCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr