ID: 943520574

View in Genome Browser
Species Human (GRCh38)
Location 2:188944487-188944509
Sequence CAGCGCCCACTGGTGAGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943520571_943520574 -8 Left 943520571 2:188944472-188944494 CCGCAGAGCAGAGGGCAGCGCCC No data
Right 943520574 2:188944487-188944509 CAGCGCCCACTGGTGAGGCTCGG No data
943520562_943520574 25 Left 943520562 2:188944439-188944461 CCTCAGCCCTTGGGCAGGTGATG No data
Right 943520574 2:188944487-188944509 CAGCGCCCACTGGTGAGGCTCGG No data
943520570_943520574 -1 Left 943520570 2:188944465-188944487 CCAGGCACCGCAGAGCAGAGGGC No data
Right 943520574 2:188944487-188944509 CAGCGCCCACTGGTGAGGCTCGG No data
943520566_943520574 18 Left 943520566 2:188944446-188944468 CCTTGGGCAGGTGATGGGACCAG No data
Right 943520574 2:188944487-188944509 CAGCGCCCACTGGTGAGGCTCGG No data
943520565_943520574 19 Left 943520565 2:188944445-188944467 CCCTTGGGCAGGTGATGGGACCA No data
Right 943520574 2:188944487-188944509 CAGCGCCCACTGGTGAGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943520574 Original CRISPR CAGCGCCCACTGGTGAGGCT CGG Intergenic
No off target data available for this crispr