ID: 943522179

View in Genome Browser
Species Human (GRCh38)
Location 2:188966059-188966081
Sequence AGTTAACTACAGCAATGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943522178_943522179 3 Left 943522178 2:188966033-188966055 CCTTATTTCTAGTGAAGCAGAAG No data
Right 943522179 2:188966059-188966081 AGTTAACTACAGCAATGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943522179 Original CRISPR AGTTAACTACAGCAATGTAG TGG Intergenic
No off target data available for this crispr