ID: 943524864

View in Genome Browser
Species Human (GRCh38)
Location 2:189003997-189004019
Sequence CCAGGTCCCAGCGGTTCTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 967
Summary {0: 1, 1: 0, 2: 5, 3: 166, 4: 795}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943524864 Original CRISPR CCAGGTCCCAGCGGTTCTCC AGG Exonic
900121552 1:1050547-1050569 CCAGGTCGTAGCGGAACTCCAGG - Exonic
900159978 1:1218886-1218908 CCTGGTACCAGCGGTCCTTCAGG + Exonic
900170322 1:1264812-1264834 CCAGGTTCAAGCGATTCTCCTGG - Exonic
900318922 1:2073006-2073028 CCAGGTCCCAGGGTTTGTCAGGG + Intronic
900327981 1:2119878-2119900 CCAGGTTCAAGCGATTCTCCTGG + Intronic
900487213 1:2928753-2928775 GCAGGTCCGAGCTGTTCTCACGG + Intergenic
900524959 1:3124091-3124113 CCGGGTCCCAGCAGTTCTTGGGG - Intronic
900633290 1:3649912-3649934 CCAGGTCCCCGCCGCTCACCAGG + Exonic
900676340 1:3888898-3888920 CCGGGTTCAAGCGATTCTCCAGG - Intergenic
900692473 1:3988882-3988904 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
901168569 1:7237183-7237205 CCAGTTCCCAGTGGGACTCCAGG - Intronic
901371779 1:8805102-8805124 CCAGGTTCAAGCGATTGTCCCGG + Intronic
901531281 1:9854272-9854294 CCAGGTTCAAGCGATTCTCCTGG - Intronic
901892396 1:12278362-12278384 CCAGGTTCAAGTGATTCTCCTGG + Intronic
902419141 1:16263902-16263924 CCAGGTTCAAGCGATTCTCCTGG + Intronic
902536182 1:17120335-17120357 CCATGTCCCAGCCCTTCCCCTGG + Intergenic
902649204 1:17825784-17825806 GCATGTCCCATCGGTCCTCCTGG + Exonic
902737765 1:18412606-18412628 GCAGGTCCCAGGGGGTCCCCAGG - Intergenic
902785213 1:18728769-18728791 CCAGGTTCAAGCAATTCTCCTGG - Intronic
903097290 1:20989461-20989483 CCAGGTTCAAGTGATTCTCCTGG - Intronic
903246294 1:22018113-22018135 CCGGGTTCCAGTGATTCTCCTGG + Intergenic
903485054 1:23683766-23683788 CCCGGTTCAAGCGATTCTCCTGG + Intergenic
903822950 1:26117123-26117145 CCAGGTTCAAGTGATTCTCCTGG + Intronic
904146281 1:28394688-28394710 CCAGGTTCAAGTGATTCTCCTGG + Intronic
904186929 1:28712741-28712763 CCAGGTTCAAGCAATTCTCCTGG - Intronic
904217974 1:28939535-28939557 CCGGGTTCAAGCGATTCTCCTGG + Intronic
904462542 1:30688786-30688808 CCAGGTTCAAGCCATTCTCCTGG + Intergenic
904663634 1:32103423-32103445 CCAGGTTCAAGCGATTCTCGTGG - Intergenic
904729332 1:32576964-32576986 CCAGGTCCAAGTGATTCTCCTGG + Intronic
905005633 1:34707467-34707489 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
905065975 1:35183309-35183331 CCAGGTTCAAGCAATTCTCCTGG + Exonic
906429455 1:45743329-45743351 CCAGGTTCAAGCAATTCTCCTGG + Intronic
906438349 1:45816769-45816791 CCAGGTTCAAGCGATTCTCCTGG + Intronic
906684824 1:47756543-47756565 CCCCGTCCCAGAGGTTGTCCCGG - Intergenic
908288379 1:62635441-62635463 CCAGGTTCAAGCGATTCCCCTGG - Intronic
908345123 1:63224774-63224796 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
908870244 1:68602222-68602244 CCAGGTCACAAGGCTTCTCCAGG - Intergenic
910242624 1:85103791-85103813 CCAGGTTCAAGTGATTCTCCTGG - Intronic
910283820 1:85530895-85530917 CCAGGTTCAAGTGATTCTCCTGG - Intronic
910568515 1:88674599-88674621 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
910780785 1:90930190-90930212 CCAGGTTCAAGTGATTCTCCTGG - Intronic
910782458 1:90954498-90954520 CCAGGTTCAAGCAATTCTCCTGG + Intronic
911187857 1:94921299-94921321 CCAGGTTCAAGCAATTCTCCTGG - Intronic
911897571 1:103456681-103456703 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
912458186 1:109813346-109813368 CCAGGTTCAAGTGGTTCTCCTGG + Intergenic
912829499 1:112939597-112939619 CCAGGTTCAAGTGATTCTCCTGG + Intronic
912983737 1:114404226-114404248 CCAGGTTCAAGCAATTCTCCTGG + Intronic
913022513 1:114802236-114802258 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
914206199 1:145532095-145532117 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
914374098 1:147057427-147057449 CCAGGTACAAGCGATTCTCCAGG - Intergenic
914687671 1:149995483-149995505 CCAGGTTCAAGCGATTCCCCTGG - Intronic
914796554 1:150924914-150924936 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
914803533 1:150976487-150976509 CCAGCTCCCAGGGTTTCTCTAGG + Intergenic
914805382 1:150987632-150987654 CCAGGTTCAAGTGATTCTCCAGG - Intronic
914833714 1:151190074-151190096 CCGGTTCCCAGCGGTCTTCCGGG + Exonic
914899208 1:151703064-151703086 GCAGGCCCCTGCGGCTCTCCTGG + Exonic
915119782 1:153622275-153622297 CCAGGTTCAAGCGATTTTCCTGG - Intronic
915191167 1:154151994-154152016 CCAGGTTCAAGCGATTCTCCTGG - Intronic
915193151 1:154168926-154168948 CCAGATTCAAGCGATTCTCCTGG + Intronic
915218597 1:154356138-154356160 TCTAGCCCCAGCGGTTCTCCAGG - Intergenic
915480763 1:156183225-156183247 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
915658843 1:157383965-157383987 CCAGGTTCTAGCAATTCTCCTGG - Intergenic
915674175 1:157515415-157515437 CCAGGGCCCAGCACATCTCCTGG - Exonic
915821524 1:159029772-159029794 CCAGGTTCAAGCAATTCTCCTGG + Intronic
915941565 1:160121498-160121520 CCAGGCCCCAGAGGGCCTCCAGG + Intronic
916036438 1:160926720-160926742 CCAGGTTCAAGTGATTCTCCTGG - Intergenic
916085272 1:161264421-161264443 CCAGGTTCAAGCAATTCTCCTGG - Intronic
916100421 1:161389382-161389404 CCAGGTGCAAGCGATTCTCCTGG - Intergenic
916216647 1:162400853-162400875 CCTGGTTCAAGCGATTCTCCTGG - Intronic
916713638 1:167432835-167432857 CCAAGTCCCAGCTGTGCTCCAGG + Intronic
918056568 1:181026546-181026568 TCAGGAACCAGAGGTTCTCCTGG - Intergenic
918343480 1:183586238-183586260 CCAGGCTCAAGCGATTCTCCTGG - Intronic
918486106 1:185029988-185030010 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
918623914 1:186636332-186636354 CCAGGTTCAAGCAGTTCTCCTGG - Intergenic
919023195 1:192135161-192135183 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
919025076 1:192157813-192157835 CCAGGTTCAAGGGATTCTCCTGG + Intergenic
919729429 1:200903388-200903410 CCAGGTTCAAGGGATTCTCCTGG - Intronic
919822412 1:201481601-201481623 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
920022751 1:202967603-202967625 CCAGTTTCAAGTGGTTCTCCTGG + Intergenic
920249506 1:204614169-204614191 CCAGGTTCCAGCGATTCTCCTGG + Intergenic
920358627 1:205395498-205395520 CCAGGTTCAAGCAATTCTCCTGG - Intronic
921068658 1:211641022-211641044 CCCGGTTCAAGCGATTCTCCTGG - Intergenic
921144829 1:212344063-212344085 CCAGGTTCAAGCGATTCTCCTGG + Intronic
922468412 1:225860773-225860795 CCAGGTCACACCTGTGCTCCAGG + Intronic
923083580 1:230683883-230683905 CCAGGTTCAAGCTATTCTCCTGG + Intronic
923096729 1:230780957-230780979 CCAGGTTCAAGCAATTCTCCTGG + Intronic
923445695 1:234069349-234069371 CCAGGTTCAAGTGATTCTCCTGG + Intronic
924593493 1:245425498-245425520 CCAGGTTCAAGCGATTTTCCTGG + Intronic
924602663 1:245505030-245505052 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1062786821 10:271745-271767 CCAGGTCCAAGTGGATGTCCAGG - Intergenic
1063181722 10:3607394-3607416 CCAGGCCCAGGCAGTTCTCCAGG + Intergenic
1063540745 10:6931461-6931483 CCAGGTTCAAGCGATTCTCGTGG - Intergenic
1064182864 10:13134524-13134546 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1064205754 10:13322233-13322255 CCAGGTTCAAGTGATTCTCCTGG + Intronic
1064243530 10:13651577-13651599 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1064402626 10:15034205-15034227 CCAGGTTCAAGCAATTCTCCTGG + Intronic
1064441108 10:15354400-15354422 CCGGGTTCAAGCAGTTCTCCTGG - Intronic
1064625898 10:17261001-17261023 CTAGGTTCAAGCGATTCTCCTGG + Intergenic
1064763445 10:18646099-18646121 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1065258664 10:23901815-23901837 CCAGGTTCAAACGATTCTCCTGG - Intronic
1065706060 10:28472517-28472539 CCAGGTTCAAGTGATTCTCCTGG - Intergenic
1066280645 10:33914293-33914315 CCAGGTTCAAGCTATTCTCCTGG - Intergenic
1066357678 10:34700879-34700901 CCAGGTTCAAGTGATTCTCCTGG - Intronic
1066377510 10:34870726-34870748 CCAGGTTCAAGCGATTCTCATGG - Intergenic
1066388723 10:34962117-34962139 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1066572716 10:36790962-36790984 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
1067084649 10:43231369-43231391 CCAGGGCCCAGATGTTCTGCAGG - Intronic
1067107317 10:43374821-43374843 CCAGGCACCAGCCCTTCTCCAGG - Intronic
1067110814 10:43398432-43398454 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1067322192 10:45231657-45231679 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1067406774 10:46030525-46030547 CCAGGTCCGAGTGCCTCTCCAGG + Exonic
1068937827 10:62653241-62653263 CCTGGTCCCAACTGATCTCCTGG + Intronic
1069454144 10:68540500-68540522 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1069539958 10:69286640-69286662 CCAGGTTCAAGGGATTCTCCTGG + Intronic
1069603292 10:69723435-69723457 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1069912995 10:71771201-71771223 CCAGGACCCAGCAGATCTCAAGG - Intronic
1070261985 10:74865607-74865629 CCAGGCTCAAGCGATTCTCCTGG + Intronic
1070623284 10:78030595-78030617 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1070724467 10:78778783-78778805 CCAGCTCCCATCTGTCCTCCTGG - Intergenic
1071808622 10:89152894-89152916 CCACGTTCAAGCGATTCTCCTGG - Intergenic
1072041950 10:91614901-91614923 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1072074678 10:91958140-91958162 CCAGGTTCAGGCGATTCTCCTGG + Intronic
1072251865 10:93587995-93588017 CCAGGTTCAAGAGATTCTCCTGG - Exonic
1072451596 10:95543303-95543325 CCAGGTTCAAGTGATTCTCCTGG - Intronic
1072761406 10:98060016-98060038 CCAGGTTCAAGTGATTCTCCTGG - Intergenic
1072900490 10:99402629-99402651 CCAGGTCCCAGGGGTTTTGAGGG + Exonic
1073512475 10:104051498-104051520 TCAGGTTCCAGCGGCTCTCCTGG - Exonic
1073820162 10:107252896-107252918 CCAGGTTCAAGGGATTCTCCTGG + Intergenic
1074141896 10:110680491-110680513 CCAAGTCTCATCTGTTCTCCTGG + Intronic
1074274314 10:111987047-111987069 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1074877697 10:117626975-117626997 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1077491302 11:2862241-2862263 CAGGGTCCCAGGGGCTCTCCTGG + Intergenic
1077940629 11:6837660-6837682 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
1078255801 11:9657882-9657904 CCAGGTTCAAGCGATTCTCGTGG + Intergenic
1078606415 11:12780335-12780357 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1079051364 11:17163210-17163232 CCAGGTTCAAGTGATTCTCCTGG - Intronic
1079441947 11:20523938-20523960 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1080601970 11:33829328-33829350 CCAGGTCCCAGCGCCTCCCAAGG + Intergenic
1081429272 11:42957761-42957783 CCAGGTTCACGCCGTTCTCCTGG - Intergenic
1081506390 11:43721523-43721545 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1081567841 11:44270727-44270749 CGAGGTCCCCACTGTTCTCCCGG + Intronic
1081595326 11:44454829-44454851 CCAGGGCCCAGCGTCTCCCCAGG - Intergenic
1081835139 11:46147233-46147255 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1082010279 11:47445500-47445522 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1082877933 11:58007196-58007218 CCATGGCCCAGTGGTTCTGCAGG + Intergenic
1083230023 11:61311156-61311178 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1083299166 11:61731241-61731263 TCAGGGCCCAGCAGTTCCCCAGG - Intronic
1083451208 11:62746627-62746649 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1083682069 11:64356076-64356098 CCAGGTTCAAACGATTCTCCTGG + Intronic
1084016339 11:66384736-66384758 CCAGTTTCAAGCGATTCTCCTGG - Intergenic
1084092965 11:66891148-66891170 CCAGGTTCAAGTGATTCTCCTGG + Intronic
1084311714 11:68320553-68320575 CCGGGTTCCAGCTGTTCTCCTGG + Intronic
1084369374 11:68729429-68729451 CCAGGTTCAAGCCATTCTCCTGG - Intronic
1084418593 11:69049103-69049125 CCAGGTCCGGGCGGCTCACCAGG - Exonic
1084883094 11:72186022-72186044 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1085075294 11:73585772-73585794 CCTGGTTCCAGTGATTCTCCTGG - Intronic
1085772013 11:79334167-79334189 GCAGGTCCCAGCTGCTTTCCAGG + Intronic
1086108979 11:83178132-83178154 CCAGGTTCAAGTGATTCTCCTGG + Intronic
1087433920 11:98089224-98089246 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
1088331749 11:108661739-108661761 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
1088456131 11:110034693-110034715 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1089097096 11:115928149-115928171 CCAGGACCCAGTGGTTTACCAGG + Intergenic
1089265898 11:117261484-117261506 CCAGGTTCAAGAGATTCTCCAGG - Intronic
1089388513 11:118083942-118083964 CCAGGTAAAAGCGATTCTCCTGG - Intronic
1089445428 11:118548456-118548478 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1089445585 11:118549616-118549638 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1089502872 11:118942707-118942729 CCAGGTCCAAGAAATTCTCCTGG + Intronic
1089514273 11:119022076-119022098 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1089613183 11:119681017-119681039 CCGAGTCCCAGTGGTCCTCCTGG + Intronic
1090349606 11:126099364-126099386 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1091426655 12:396296-396318 CCAGGTTCAAGCGATTCTCTGGG - Intronic
1091628300 12:2139484-2139506 CAAGGCCCCAGCTGTACTCCAGG - Intronic
1091642011 12:2244491-2244513 CCAGGTCCCAGCAGTAGTTCAGG + Intronic
1092030356 12:5278584-5278606 GCAGGTGCCACCCGTTCTCCAGG - Intergenic
1092354064 12:7779879-7779901 CCAGGTTCAAGGGATTCTCCTGG - Intergenic
1092369401 12:7904139-7904161 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
1092747911 12:11690791-11690813 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1093055121 12:14548361-14548383 CCAGGTTCAAGCGATTCTCTAGG - Intronic
1093907760 12:24712896-24712918 CCAGGTTCAAGCTGTTCTCCAGG - Intergenic
1094199303 12:27780360-27780382 CCGGGTAGCAGCGGTCCTCCAGG - Exonic
1094625902 12:32123781-32123803 CCAGGTTCAAGCTATTCTCCTGG - Intronic
1094675953 12:32620618-32620640 CCAGGTTCAAGCTATTCTCCTGG + Intronic
1094714684 12:33001048-33001070 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1095466358 12:42491457-42491479 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1095742322 12:45620999-45621021 CCAGGTTCAAGAGATTCTCCTGG - Intergenic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1096667851 12:53178689-53178711 CCAGGTTCAAGCAATTCTCCTGG - Intronic
1096728363 12:53584071-53584093 CCAAGTTCAAGCGATTCTCCTGG + Intronic
1097020109 12:56014701-56014723 CCGGGTTCAAGCAGTTCTCCTGG - Intronic
1097082986 12:56446736-56446758 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1098469551 12:70827637-70827659 CCAGGTTCAAGCAATTCTCCTGG + Intronic
1098557591 12:71837309-71837331 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
1099176928 12:79432705-79432727 CCAGGTTCAAGCAATTCTCCTGG + Intronic
1099339258 12:81407387-81407409 CCAGGTTCAAGGGATTCTCCTGG - Intronic
1099443648 12:82727625-82727647 CCAGGTTCAAGTGATTCTCCTGG - Intronic
1099611145 12:84872061-84872083 CCAGGTTCAAGCAATTCTCCTGG - Intronic
1099979304 12:89580697-89580719 CCAGGTTCAAGCGATTCTTCTGG + Intergenic
1100101197 12:91107807-91107829 CCAGGTTCAAGCAATTCTCCTGG + Intronic
1100298569 12:93285697-93285719 CCAGGTTCAAGGGATTCTCCTGG - Intergenic
1100391603 12:94149481-94149503 CCAGGTACCAGCGGTTGTTCCGG - Exonic
1101088198 12:101257602-101257624 CCAGGTCCCAGAGGGTCACTTGG - Intergenic
1101101035 12:101392722-101392744 CCAGGCGCAAGCGATTCTCCTGG - Intergenic
1101142952 12:101814601-101814623 CCAGGTTCAAGCAATTCTCCTGG - Intronic
1101316508 12:103633586-103633608 CCGGGTTCGAGCGATTCTCCCGG - Intronic
1101584269 12:106070888-106070910 CCAGGGCCCAGCTGTCCACCTGG + Exonic
1101965153 12:109277271-109277293 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1102041889 12:109806286-109806308 CCAGGTTCAAGTGATTCTCCTGG + Intronic
1102177046 12:110883731-110883753 CCAGGTTCAAGCAATTCTCCTGG + Intronic
1102312741 12:111859741-111859763 CCTGGTTCAAGCGATTCTCCTGG + Intronic
1102985070 12:117271369-117271391 CCTGGTTCAAGCGATTCTCCTGG + Intronic
1103134093 12:118492683-118492705 CCAGGTTCAAGCCATTCTCCTGG + Intergenic
1103476240 12:121221062-121221084 CCAGGTTCCAGTGATTCTCCTGG + Intronic
1103536439 12:121636942-121636964 CCAGGTTCAAGCGATTCTCATGG + Intronic
1103560412 12:121790535-121790557 CCAGGTCCCAGTGCTTGTCATGG - Intronic
1103588822 12:121976100-121976122 CTAGGTTCAAGCGGTTCTCCTGG + Intronic
1103646085 12:122393816-122393838 CCAGGTTCAAGTGATTCTCCTGG - Intronic
1103687334 12:122742536-122742558 CCGGGTTCAAGCAGTTCTCCTGG + Intergenic
1103799184 12:123526210-123526232 TCAGGTTCAAGCAGTTCTCCTGG - Intronic
1103942152 12:124506939-124506961 CCAGGTCCCACCGCCTCTCCAGG - Intronic
1104385602 12:128349095-128349117 CCAGGTTCAAGTGATTCTCCTGG + Intronic
1104490291 12:129188255-129188277 GCAGGTCCCAGCTGGCCTCCTGG + Intronic
1104682880 12:130763374-130763396 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
1104861088 12:131924074-131924096 CCGGGTTCAAGCGATTCTCCAGG + Intergenic
1105070510 12:133231685-133231707 GCAGGTCCCAACAGTGCTCCAGG - Intronic
1105333552 13:19440991-19441013 CCAGGTTCAAGTGATTCTCCTGG - Intronic
1105366455 13:19769639-19769661 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1105546866 13:21356933-21356955 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
1106246733 13:27956163-27956185 CTAGGTTCAAGCGATTCTCCTGG - Intergenic
1106484600 13:30161094-30161116 CCAGATTCAAGCAGTTCTCCCGG + Intergenic
1106835265 13:33627541-33627563 CCAGGTTCGAGTGATTCTCCTGG - Intergenic
1107122231 13:36808250-36808272 CCAGGTTCAAGTGATTCTCCTGG - Intergenic
1107514449 13:41115380-41115402 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1107935408 13:45341522-45341544 CCAGCTCCCAGCACCTCTCCAGG - Intergenic
1108695761 13:52901098-52901120 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1110185432 13:72668529-72668551 CCAGGTTCAAGCCATTCTCCTGG - Intergenic
1110761429 13:79234869-79234891 CCAGGTTCAAGTGATTCTCCTGG - Intergenic
1111027586 13:82551804-82551826 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1112262721 13:97892172-97892194 CCAGATTCAAGCGATTCTCCTGG + Intergenic
1112520271 13:100088930-100088952 CCAGGTCCTAGCGCGACTCCCGG + Intergenic
1112926941 13:104687860-104687882 CCAGGCCCCTGCGGTTCTGATGG + Intergenic
1113006976 13:105717294-105717316 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1113320903 13:109231036-109231058 CCAGGTCCAAGTGATTCTCCTGG + Intergenic
1113419829 13:110162424-110162446 CCAGGTCCAAGAGGATTTCCAGG - Exonic
1113450070 13:110402790-110402812 CCTGGTCACAGAAGTTCTCCAGG + Intronic
1113523032 13:110953998-110954020 CCATGTCCCTGAGGTTGTCCTGG - Intergenic
1113702337 13:112396811-112396833 CCATGTCCCTGAGGTTGTCCTGG + Intronic
1114076586 14:19164590-19164612 CCAGGTCTCAGGGGTACACCAGG - Intergenic
1114347043 14:21807479-21807501 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1114824648 14:26062421-26062443 CCAGGGCCCAGCAGTTTACCAGG + Intergenic
1115045583 14:28989252-28989274 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1115136928 14:30121519-30121541 CTGGGTTCCAGCGATTCTCCTGG + Intronic
1115250661 14:31343184-31343206 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1115887097 14:37984782-37984804 CCAGGTTCAAGCAATTCTCCTGG + Intronic
1117156290 14:52945342-52945364 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1117392365 14:55273897-55273919 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1118585366 14:67347593-67347615 CCAGGTTCAAGCAATTCTCCTGG + Intronic
1118974458 14:70664921-70664943 CCAGTTCCCACCGGATCTGCAGG + Intronic
1119002546 14:70895621-70895643 CCAGGTTCAAGAGATTCTCCTGG - Intergenic
1119240384 14:73054588-73054610 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1119250489 14:73148837-73148859 CTGGGTTCCAGCGATTCTCCTGG - Intronic
1119344757 14:73914265-73914287 CCAGGTTCAAGTGATTCTCCTGG + Intronic
1119787402 14:77323813-77323835 CCACCTCCCAGCAGTCCTCCGGG - Intronic
1120112396 14:80573014-80573036 TCAGGTTCAAGCGATTCTCCTGG + Intronic
1120621111 14:86765797-86765819 CCAGGTTCAAGAGATTCTCCTGG + Intergenic
1120704494 14:87733253-87733275 CCAGGTTCAAGTGATTCTCCTGG - Intergenic
1120790956 14:88581465-88581487 CCGGATCCAAGCGATTCTCCTGG - Intronic
1120910034 14:89658067-89658089 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
1120962696 14:90139866-90139888 CCAGGTTCAAGCGATTCTCATGG - Intronic
1121049625 14:90812003-90812025 CCAGGTCCCAGCTGTCAGCCTGG - Intronic
1121216721 14:92254203-92254225 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1121641765 14:95489337-95489359 GCAGCTGCCAGGGGTTCTCCTGG + Intergenic
1122484920 14:102072703-102072725 CCAGGTTCAAGTGATTCTCCTGG - Intergenic
1122618096 14:103035149-103035171 CCAGGTTCCAGCAATTCTCCTGG + Intronic
1122684456 14:103494138-103494160 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1122698398 14:103569948-103569970 CCAGGTTCAAGCAATTCTCCTGG + Intronic
1122707209 14:103628979-103629001 GCAGGACCCAGCGGGCCTCCCGG - Intronic
1122743206 14:103883481-103883503 CCAGACCACAGCGGCTCTCCAGG - Intergenic
1122777566 14:104128168-104128190 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1202892333 14_KI270722v1_random:170102-170124 CCAGCTCCCAGGGTATCTCCTGG - Intergenic
1123950066 15:25262576-25262598 CCAGGTTCAAGCAATTCTCCGGG + Intergenic
1124641263 15:31397973-31397995 CCACCTCCCAGCTGCTCTCCGGG + Intronic
1124650484 15:31470172-31470194 CCAGGACCCAGGGGTACGCCAGG - Intergenic
1124719947 15:32103314-32103336 CCAGGTTCAAGTGATTCTCCTGG - Intronic
1124955315 15:34356406-34356428 CCAGGTACTAGGGTTTCTCCAGG - Exonic
1125133009 15:36306252-36306274 CCAGGTTCAAGGGATTCTCCAGG + Intergenic
1125287564 15:38110264-38110286 CCCGGTTCAAGCGATTCTCCTGG - Intergenic
1125683178 15:41545733-41545755 CCAGGTTCAAGTGATTCTCCTGG - Intergenic
1125978083 15:43973459-43973481 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1126384803 15:48083133-48083155 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
1126757039 15:51935023-51935045 CCAGGTTCAAGTGATTCTCCTGG - Intronic
1126770336 15:52049706-52049728 CCGGGTTCGAGCGATTCTCCTGG + Intronic
1126790513 15:52217326-52217348 CCAGGACCGAGCTGTGCTCCAGG + Intronic
1127576469 15:60296719-60296741 CCAGGTTCAAGCACTTCTCCTGG - Intergenic
1127928777 15:63576078-63576100 CCAGGTTCAAGTGATTCTCCTGG + Intronic
1128819260 15:70637415-70637437 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1128822559 15:70673000-70673022 CCAGGTTCAAGCAGTTCTCCTGG - Intronic
1128825157 15:70708559-70708581 CCAGGTTCAAGCTATTCTCCTGG + Intronic
1128910296 15:71507718-71507740 CCAAGTCCAAGCTTTTCTCCAGG - Intronic
1129086417 15:73097452-73097474 CCAGGTTCAAGCGATTCTGCTGG + Intronic
1129429801 15:75491307-75491329 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1129620099 15:77136570-77136592 CGAGGTTCAAGCGATTCTCCTGG - Intronic
1129943764 15:79521352-79521374 CCAGGTCCCTGCCTTTCTCAGGG + Intergenic
1129983130 15:79892855-79892877 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1130084653 15:80767199-80767221 CCAGGTTCAAGTGATTCTCCTGG - Intergenic
1130169638 15:81497972-81497994 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
1130221301 15:82021846-82021868 CCTGGTTCCACCAGTTCTCCTGG + Intergenic
1130222660 15:82033669-82033691 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1130754247 15:86745831-86745853 CCAAGTGCCTGGGGTTCTCCAGG - Intronic
1131234174 15:90681996-90682018 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
1131260364 15:90884563-90884585 CCAGCTCCCACCGCTCCTCCAGG - Intronic
1131974934 15:97934849-97934871 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
1132095415 15:98980836-98980858 CCAGGTTCGAGCAATTCTCCTGG - Intronic
1132574061 16:656669-656691 CAAGGGCCCAGGGGCTCTCCAGG - Intronic
1132674656 16:1116733-1116755 CCAGGCCCCAGAGGTCCTCCCGG + Intergenic
1132850749 16:2023861-2023883 GCAGGTCTCAGCCGTTCCCCTGG - Intergenic
1133216550 16:4296052-4296074 CCTGGTTCAAGCGATTCTCCTGG + Intergenic
1133524870 16:6594880-6594902 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1133594192 16:7274776-7274798 CCAGGTTCCAGTGATTCTCATGG + Intronic
1134087491 16:11368080-11368102 CCAGGTTCAAGCTATTCTCCTGG + Intronic
1134527495 16:14955593-14955615 CCAAGTTCAAGCGATTCTCCTGG + Intergenic
1134560457 16:15204769-15204791 TCTGGTCCCAGCTGCTCTCCAGG + Intergenic
1134649046 16:15893770-15893792 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1134761641 16:16719809-16719831 CCGGGTTCCAGCGATTCTCCTGG - Intergenic
1134911964 16:18035526-18035548 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
1134920996 16:18116383-18116405 TCTGGTCCCAGCTGCTCTCCAGG + Intergenic
1134984416 16:18639361-18639383 CCGGGTTCCAGCGATTCTCCTGG + Intergenic
1135193958 16:20379265-20379287 CCGGGTTCCAGTGATTCTCCTGG + Intronic
1135410656 16:22231894-22231916 CCAGGTTCAAGTGATTCTCCTGG - Intronic
1135511698 16:23090290-23090312 CCAGGTTCAAGCGATTCTCTTGG - Intronic
1135726779 16:24860360-24860382 CCAGGTTCAAGTGATTCTCCTGG - Intronic
1135772228 16:25226349-25226371 CCAGGTTCAAGCAATTCTCCTGG + Intronic
1135997107 16:27258842-27258864 CCGGGTTCCAGTGATTCTCCTGG + Intronic
1136058775 16:27710262-27710284 CCAGGTTCAAGCGACTCTCCTGG - Intronic
1136110817 16:28062947-28062969 CCAGCTCCCAGCGCTCCGCCTGG - Intronic
1136179251 16:28539527-28539549 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1136542254 16:30934562-30934584 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1136780062 16:32892766-32892788 CTAGGTTGCAGAGGTTCTCCTGG - Intergenic
1136890548 16:33968761-33968783 CTAGGTTGCAGAGGTTCTCCTGG + Intergenic
1137486243 16:48893939-48893961 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
1137644742 16:50064160-50064182 CCAGGTTCAAGAGATTCTCCTGG + Intergenic
1137739969 16:50759146-50759168 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1138442683 16:57044565-57044587 GCAGGTCCCAGAGCCTCTCCAGG + Intronic
1138463488 16:57168707-57168729 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1138543684 16:57703871-57703893 GCAGGTTCAAGCGATTCTCCTGG - Intronic
1139189207 16:64841958-64841980 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1139277526 16:65741656-65741678 CCAAGTCCTAGTGATTCTCCTGG - Intergenic
1139425564 16:66877825-66877847 CCGGGTTCAAGCGATTCTCCCGG - Intergenic
1139803751 16:69546136-69546158 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1140441159 16:74988868-74988890 CCGGGTTCAAGCGATTCTCCCGG - Intronic
1140769392 16:78189746-78189768 CCAAGTTCAAGCGATTCTCCTGG + Intronic
1140779629 16:78282782-78282804 CGAGGTTCAAGCGATTCTCCTGG - Intronic
1141031626 16:80594193-80594215 CCAGGTCTCAGCTGGGCTCCTGG + Intergenic
1141218454 16:82046628-82046650 CCAGGTTCAAGCGATCCTCCTGG - Intronic
1141447832 16:84073910-84073932 CCAGGTTCAAGCGATTCTACTGG - Intronic
1141643841 16:85357012-85357034 CCAGGCCCCAGGGGATCTCTGGG + Intergenic
1142190386 16:88714673-88714695 CCGGGGCCCTGCTGTTCTCCAGG + Exonic
1142288870 16:89183583-89183605 CCAGGTCCGTGGGGTCCTCCAGG - Exonic
1142370656 16:89679024-89679046 CCAGGTTCAAGCAGTTCTCCTGG + Intergenic
1142377803 16:89715767-89715789 CCAGGATCAAGCGATTCTCCTGG + Intronic
1203082483 16_KI270728v1_random:1154853-1154875 CTAGGTTGCAGAGGTTCTCCTGG - Intergenic
1142636131 17:1259049-1259071 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1142656111 17:1395433-1395455 CCAGGTTCAAGCGGTTCTCCTGG - Intronic
1142979574 17:3663867-3663889 TCATGTCCCAGCCGTTCACCTGG + Exonic
1143133328 17:4694913-4694935 CCGGGTTCAAGCGATTCTCCCGG - Intronic
1143302210 17:5918892-5918914 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1143463628 17:7120744-7120766 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1143638591 17:8181795-8181817 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1143668985 17:8383514-8383536 GAAGGTACCAGCGGGTCTCCTGG - Intergenic
1143874563 17:9981851-9981873 GAACGTCCCAGCAGTTCTCCTGG - Exonic
1144190805 17:12843747-12843769 CCAGGTTCAAGTGATTCTCCCGG + Intronic
1144258572 17:13495359-13495381 CCAGGTCTCAGTGGTTTTCTTGG + Intergenic
1144406316 17:14955900-14955922 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1144577882 17:16440759-16440781 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1144580276 17:16455024-16455046 CCAGGTTCAAGTGATTCTCCTGG + Intronic
1144799701 17:17917236-17917258 CCAGGTTCGAGTGATTCTCCTGG - Intronic
1144938241 17:18917478-18917500 CCAGGTTCAGGCGATTCTCCTGG + Intronic
1145238489 17:21225748-21225770 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
1145346701 17:22046485-22046507 CCGGGTCCCAGTGGATCTTCAGG + Intergenic
1146325705 17:31884090-31884112 CCAGGTTCAAGCGAGTCTCCTGG + Intronic
1146387782 17:32392599-32392621 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1146897421 17:36554459-36554481 CCGGGTTCAAGTGGTTCTCCTGG + Intronic
1147699391 17:42383148-42383170 CCAGGTTCAAGCAATTCTCCTGG + Intronic
1147738694 17:42657589-42657611 TCAGGTTCAAGCGATTCTCCTGG - Intergenic
1148105529 17:45116736-45116758 CCAGCCCGCAGTGGTTCTCCAGG + Exonic
1148113685 17:45162231-45162253 CCAGGTCCCAGCTGTGCTTCTGG + Intronic
1148802465 17:50239811-50239833 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
1148885562 17:50769826-50769848 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1148904355 17:50902463-50902485 CCAGGTTCAAGTGATTCTCCTGG - Intergenic
1150173014 17:63020018-63020040 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1150258080 17:63765432-63765454 CCAGGTTCAAGCGATTCTCTTGG + Intronic
1150569397 17:66372963-66372985 CCAGGTTCCAGCAATTCTGCTGG - Intronic
1150823036 17:68450984-68451006 CCAGGTTCCAAAGGTTCTCCGGG + Intronic
1150920646 17:69478524-69478546 CCAGGTTCAAGTGATTCTCCTGG + Intronic
1151004112 17:70413706-70413728 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1151233844 17:72704032-72704054 CCAGGTTCGAGTGGTTCTCATGG - Intronic
1151780929 17:76244845-76244867 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1151791330 17:76307725-76307747 CCACGCCCCTGCGCTTCTCCCGG + Intergenic
1152072499 17:78140888-78140910 CCAGGCCCGAGCGACTCTCCGGG + Exonic
1152122589 17:78427870-78427892 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1152144130 17:78557543-78557565 CCAAGTTCAAGCGATTCTCCTGG - Intronic
1152182334 17:78831130-78831152 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1152367442 17:79864695-79864717 CTAGGTTCGAGCGATTCTCCTGG - Intergenic
1152607149 17:81297544-81297566 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1152853709 17:82651733-82651755 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1152989632 18:350864-350886 CCAGGTTCAAGCAATTCTCCTGG - Intronic
1153060349 18:988758-988780 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1153536305 18:6105704-6105726 CCAGGTTCAAGTGATTCTCCAGG - Intronic
1153982437 18:10321772-10321794 CCAGGACTCAGAGGTTGTCCCGG + Intergenic
1155131702 18:22941263-22941285 CCAGGTTGAAGCAGTTCTCCTGG + Intronic
1155466702 18:26143813-26143835 CTGGGTTCCAGCGATTCTCCTGG + Intronic
1155499143 18:26469853-26469875 ACAGGTTCAAGCGATTCTCCAGG - Intronic
1156911368 18:42414546-42414568 TCAGGTCCCAGGTGTTCTTCAGG + Intergenic
1157248736 18:46075306-46075328 CCAGGCTCAAGCGATTCTCCTGG - Intergenic
1157255112 18:46131817-46131839 CCGGGTTCAAGCGATTCTCCAGG - Intergenic
1157816462 18:50732871-50732893 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1158263718 18:55637018-55637040 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1158586622 18:58743280-58743302 CCAGGTTCAAGTGATTCTCCTGG - Intronic
1158930173 18:62316356-62316378 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1158946772 18:62453875-62453897 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
1159043602 18:63347400-63347422 CCTGGTTCAAGCGATTCTCCTGG - Intronic
1159210612 18:65316656-65316678 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1159965393 18:74590365-74590387 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1160055230 18:75472582-75472604 CCAGCTGCCATCGGTTCTTCTGG + Intergenic
1160666064 19:329218-329240 CCTAGTCCCAGCCCTTCTCCAGG + Intronic
1160947135 19:1648876-1648898 CAAGGTCCCTGGGCTTCTCCAGG + Intronic
1160956164 19:1692877-1692899 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1160956272 19:1693474-1693496 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1160977327 19:1799668-1799690 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1160997590 19:1890707-1890729 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1161023194 19:2021395-2021417 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1161047076 19:2140850-2140872 CCAGGTTCAAGTGATTCTCCTGG + Intronic
1161175351 19:2839238-2839260 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1161182221 19:2891615-2891637 CCAGGTTCAAGTGATTCTCCTGG - Intergenic
1161372077 19:3918289-3918311 CCAGGTTCAAGTGATTCTCCTGG - Intronic
1161545995 19:4880263-4880285 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1161729923 19:5953244-5953266 TCAGGTCCTAGCATTTCTCCTGG + Intronic
1161799821 19:6411373-6411395 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
1161904529 19:7146333-7146355 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1161970408 19:7576303-7576325 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
1162113029 19:8411142-8411164 CCAGGTTCAAGGGATTCTCCTGG - Intronic
1162294317 19:9802629-9802651 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1162339090 19:10080898-10080920 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1162355654 19:10183207-10183229 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1162405377 19:10469923-10469945 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1162459676 19:10807164-10807186 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1162502559 19:11062354-11062376 CCAGGTCCCTGTCCTTCTCCTGG + Intronic
1162607205 19:11718714-11718736 CCAGGTTCAAGCCATTCTCCTGG + Intergenic
1162624647 19:11874916-11874938 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1162674110 19:12285347-12285369 CCGGGTCCAAGCAATTCTCCTGG + Intronic
1162697461 19:12487378-12487400 CCAGGTACAAGTGATTCTCCTGG + Intronic
1162907491 19:13832427-13832449 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1162942574 19:14022002-14022024 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1163106651 19:15126986-15127008 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1163409475 19:17144874-17144896 CCGAGTTCAAGCGGTTCTCCTGG - Intronic
1163555832 19:17992505-17992527 CCCGGTTCAAGCGATTCTCCTGG - Intronic
1163656673 19:18550061-18550083 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1163707558 19:18824251-18824273 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1163827474 19:19531823-19531845 CCGGGTTCAAGCGATTCTCCAGG + Intronic
1163856094 19:19703472-19703494 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1163924751 19:20329619-20329641 CCAGGTTCAAGCGATTCTCTTGG - Intergenic
1165178024 19:33944314-33944336 CCAGGTTCAAGTGATTCTCCCGG + Intergenic
1165226398 19:34358240-34358262 CCAGGTTCAAGCGATTCTCTGGG - Intergenic
1165238306 19:34441825-34441847 CCAGGTTCAAGCGGCTCTCATGG - Intronic
1165243814 19:34486459-34486481 CCAGGTTCAAGTGATTCTCCTGG + Intronic
1165406970 19:35636990-35637012 CCAGGTGCCAGCAGAGCTCCTGG + Intronic
1165430030 19:35767229-35767251 CCAGCTCCCACGGGTTCTTCTGG + Intronic
1165461159 19:35945068-35945090 CCAGGTCCCACAGGGTGTCCGGG - Exonic
1165504561 19:36217154-36217176 CCAGGTTCAAGCGATTCTCTTGG + Intronic
1165689404 19:37851648-37851670 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
1165787840 19:38473195-38473217 CCAGGGCCCAGCGGTGTACCCGG + Intronic
1165816857 19:38647844-38647866 CCCGGTCCCAGTCGTCCTCCTGG - Exonic
1165962038 19:39543094-39543116 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
1166320612 19:42016325-42016347 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1166639090 19:44479292-44479314 CTAGGTCCCTGTGGTTCTCCAGG + Exonic
1166769885 19:45275165-45275187 CCAGGTTCAAGTGATTCTCCTGG - Intronic
1166928577 19:46286892-46286914 CCAGGTTCAAGCGACTCTCCTGG + Intergenic
1167023663 19:46898146-46898168 CCAGGTTCAAGTGATTCTCCTGG - Intergenic
1167053638 19:47095306-47095328 CCTGTTTCCAGCGGTTCTCATGG - Intronic
1167218027 19:48177989-48178011 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1167332234 19:48863345-48863367 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1167341585 19:48919569-48919591 CCAGGTTCAAGCAATTCTCCTGG + Intronic
1167412296 19:49351890-49351912 CCGGGTTCAAGCAGTTCTCCTGG - Intronic
1167459640 19:49618002-49618024 CCAGGTTCAAGTGATTCTCCTGG - Intronic
1167836862 19:52079895-52079917 CCAGGTTCAAGCGATCCTCCTGG - Intronic
1167994710 19:53392996-53393018 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1168003218 19:53465617-53465639 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1168043864 19:53780098-53780120 CCAGGTTCAAGAGATTCTCCTGG - Intergenic
1168322200 19:55517301-55517323 CCAGGTCCCTCCGCCTCTCCGGG + Exonic
1168663707 19:58186437-58186459 CCATGTTCAAGCAGTTCTCCTGG - Intronic
925974430 2:9131645-9131667 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
926482553 2:13417874-13417896 CCAGGTTCAAGCAATTCTCCAGG - Intergenic
927761451 2:25759046-25759068 CCAGGTTCAAGCGATTCTCCTGG + Intronic
927836825 2:26405752-26405774 CCAGGTTCAAGTGATTCTCCTGG + Intronic
928670016 2:33593308-33593330 CCAGGTTCAAGCAATTCTCCAGG - Intronic
928945886 2:36771430-36771452 CCGGGTTCAAGCGATTCTCCTGG - Intronic
929149989 2:38738845-38738867 CCAGGTTCAAGCAATTCTCCTGG - Intronic
929464731 2:42134178-42134200 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
929820161 2:45266869-45266891 CCAGGTTCAAGCGATTCTCGTGG + Intergenic
930330554 2:49978066-49978088 CCTGGTTCAAGCGATTCTCCTGG - Intronic
930564779 2:53005224-53005246 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
930663810 2:54082337-54082359 GCAGGTTCAAGCGGTTCTCCTGG + Intronic
930748352 2:54907412-54907434 CCCGGTTCAAGCGATTCTCCTGG - Intronic
931329255 2:61263100-61263122 CCAGGTTCAAGCGATTCTCCTGG + Intronic
931367024 2:61627907-61627929 CCTGGTCCCAGCTGTTTTCATGG - Intergenic
931769435 2:65485131-65485153 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
932261137 2:70328646-70328668 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
932274721 2:70443279-70443301 CCAGGGCCCAGAGGGTCTCCTGG - Intergenic
932680458 2:73820262-73820284 CCAGGTTCAAGCGATCCTCCTGG + Intergenic
932822044 2:74909784-74909806 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
933126080 2:78607928-78607950 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
933410171 2:81915683-81915705 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
933673778 2:85034713-85034735 CCAAGTTCAAGCGATTCTCCTGG + Intronic
934652877 2:96102393-96102415 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
934914765 2:98292147-98292169 CCAGGTTCTAGTGATTCTCCTGG - Intronic
937136453 2:119557863-119557885 CCAGGTTCAAGTGATTCTCCTGG - Intronic
938812204 2:134863679-134863701 CCAGCACCCAGCGGTGCCCCCGG - Intronic
938844641 2:135196184-135196206 CCAGGTTCAAGTGATTCTCCTGG + Intronic
938855364 2:135305069-135305091 CCAGGTTCAAGCAATTCTCCTGG + Intronic
938897649 2:135768290-135768312 CCAGGTTCAAGCGATTCTCCTGG + Intronic
940745220 2:157560050-157560072 CCAGGTCCACGCAGGTCTCCAGG - Intronic
940838030 2:158547151-158547173 CTATGGCCCAGCAGTTCTCCTGG + Intronic
941487193 2:166097113-166097135 CCAGGTTCAAGCAATTCTCCTGG + Intronic
942107285 2:172645362-172645384 CCGGGTTCAAGCGGTTCTCCTGG + Intergenic
942735350 2:179104607-179104629 CCAGTTCCCAGTGAATCTCCAGG - Exonic
943524864 2:189003997-189004019 CCAGGTCCCAGCGGTTCTCCAGG + Exonic
945625401 2:212198666-212198688 CCGGGTTCAAGCGATTCTCCTGG + Intronic
945651349 2:212564161-212564183 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
946402163 2:219473812-219473834 CCATGTCCCGGCGGCTCACCCGG - Exonic
946620457 2:221556388-221556410 CCAGGTTCAAACGATTCTCCTGG + Intronic
947163677 2:227240158-227240180 CCTGGACCCCCCGGTTCTCCTGG + Exonic
947165836 2:227261078-227261100 CCAGGTCCCAGTGGTCCCCCCGG + Exonic
947170182 2:227303062-227303084 CCAGGACCCAGAGGTGATCCTGG + Exonic
947403870 2:229754710-229754732 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
947780289 2:232754069-232754091 CCAGGTTCAAGCGATTCTCCTGG - Intronic
947859021 2:233345625-233345647 CCAGGTTCAAGTGATTCTCCTGG - Intronic
947885871 2:233570524-233570546 CCAGGTTCAAGCAGTTCTCCTGG + Intergenic
948415593 2:237800818-237800840 CCAGGTTCAAGTGATTCTCCTGG + Intronic
948587782 2:239030140-239030162 CCAGGTACCAGCGTCGCTCCAGG + Intergenic
948661924 2:239512684-239512706 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
1168789499 20:566787-566809 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1169261751 20:4144339-4144361 CCAGGTTCCAGCGATTCTCCTGG + Intronic
1169371548 20:5031995-5032017 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1169793967 20:9441598-9441620 CCAGCCCCCAGAGTTTCTCCAGG - Intronic
1170127982 20:12987049-12987071 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1170281892 20:14658705-14658727 CCAGGTTCAAGCAATTCTCCTGG + Intronic
1170976925 20:21173482-21173504 CCAGGTTCAAGCAATTCTCCTGG - Intronic
1171723890 20:28596669-28596691 CCAGGTTCAAGTGATTCTCCTGG - Intergenic
1172307545 20:33891998-33892020 CCAAGTTGAAGCGGTTCTCCTGG + Intergenic
1172356916 20:34286738-34286760 CCAGGTTCAAGCGATTCGCCTGG - Intronic
1172531870 20:35636695-35636717 CCAGGTTCAAGTGATTCTCCTGG - Intronic
1172688698 20:36775800-36775822 CCAGGTTCAAGTGATTCTCCTGG - Intergenic
1172775333 20:37403671-37403693 CCCGGCCCCAGCCCTTCTCCTGG - Exonic
1172911848 20:38415412-38415434 CCAAGTGCCAGCAATTCTCCAGG + Intergenic
1173797214 20:45869948-45869970 CTGGGTTCCAGCGATTCTCCTGG - Intronic
1174064814 20:47856824-47856846 CCAGGTTCAAGCGGTTCTCCAGG + Intergenic
1174067497 20:47875753-47875775 TCAGGTCCCAGGGCTTCTCCTGG + Intergenic
1174156818 20:48521167-48521189 CCGGGTCCCAGGGCTTCTCCTGG - Intergenic
1174226044 20:49001152-49001174 CCAGGTTCAAGCTATTCTCCTGG + Intronic
1174597035 20:51692509-51692531 CCACCTCCCAGGGGCTCTCCAGG - Intronic
1174740172 20:53005217-53005239 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1175051751 20:56161891-56161913 CCGGGTTCAAGCGTTTCTCCTGG - Intergenic
1175103486 20:56596844-56596866 CCGGGTACAAGCGATTCTCCTGG - Intergenic
1175239945 20:57539671-57539693 CCTGGTTCAAGCGATTCTCCTGG + Intergenic
1175761178 20:61562961-61562983 CCTGGACCCAGCCGTGCTCCTGG - Intronic
1176371361 21:6063644-6063666 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1176739493 21:10587641-10587663 CCAGGTTCAAGTGATTCTCCTGG + Intronic
1176764328 21:13000732-13000754 CCAGGTTCAAGCGATTTTCCTGG - Intergenic
1177146005 21:17407475-17407497 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
1177688299 21:24468832-24468854 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
1177754388 21:25328033-25328055 CCAGGTTCAAGTGATTCTCCTGG - Intergenic
1178394345 21:32228180-32228202 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
1178824949 21:36006953-36006975 TCAGGTTCAAGCGATTCTCCTGG - Intergenic
1178850120 21:36205914-36205936 CCAGGTTCAAGTGATTCTCCTGG - Intronic
1178863521 21:36308985-36309007 TCAGGTTCAAGCAGTTCTCCTGG + Intergenic
1179213055 21:39342129-39342151 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1179489904 21:41734444-41734466 CCTGGTCCCAGTGGTGCTACTGG - Intergenic
1179580414 21:42339935-42339957 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1179672094 21:42956458-42956480 CCAGGTTCAAGCCATTCTCCTGG - Intergenic
1179752158 21:43474895-43474917 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1180297446 22:10955359-10955381 CCAGGTTCAAGTGATTCTCCTGG - Intergenic
1180614621 22:17119564-17119586 CCCGGTCCCAGCAGCCCTCCAGG + Exonic
1180890531 22:19284859-19284881 CCCGGTTCAAGCGATTCTCCTGG - Intronic
1180904813 22:19401978-19402000 CCAGCTCCCAGGGGTTCACTGGG + Intronic
1181054930 22:20256396-20256418 CCAGCACCCAGCTGGTCTCCTGG + Intronic
1181261355 22:21600217-21600239 CCCGGTTCAAGCGATTCTCCTGG - Intronic
1181262174 22:21606411-21606433 CCAGGTTCAAGTGATTCTCCTGG + Intronic
1181276584 22:21691056-21691078 CTGGGTTCAAGCGGTTCTCCTGG + Intronic
1181281290 22:21722521-21722543 CCAGGTTCGAGTGATTCTCCTGG - Intronic
1181296641 22:21845327-21845349 CCAGGTTCAAGTGATTCTCCTGG + Intronic
1181424848 22:22828118-22828140 CCAGGTTCAAGTGATTCTCCTGG - Intronic
1181701142 22:24621954-24621976 CCAGGTTCTAGCGATTCTCCTGG - Intronic
1181714334 22:24713236-24713258 CCAGGTACAAGTGATTCTCCTGG - Intergenic
1181878174 22:25956307-25956329 CCAGGTTCAAGCGATTCTCGTGG + Intronic
1182138611 22:27932044-27932066 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1182291050 22:29280159-29280181 CCAGGTTCAAGCAATTCTCCTGG + Intronic
1182368504 22:29794396-29794418 CCAGCTTCAAGCGATTCTCCTGG - Intronic
1182464086 22:30503728-30503750 GCAGGTCCTGGAGGTTCTCCCGG + Exonic
1183174972 22:36216642-36216664 CCAGGCTCAAGCAGTTCTCCTGG - Intergenic
1183204358 22:36408448-36408470 CCGGGTCCAGGCGATTCTCCTGG + Intergenic
1183418084 22:37694158-37694180 CCAGGTTCAAGCAATTCTCCTGG - Intronic
1183642132 22:39099118-39099140 CCAGGTTCAAGTGATTCTCCCGG - Intronic
1183670253 22:39268700-39268722 CCAGGTCCCAGAGGGCCCCCAGG + Intergenic
1183737539 22:39652125-39652147 CCAGGTTCAAGCAATTCTCCAGG + Intronic
1183984899 22:41563988-41564010 CCAGGTTCCCGCCATTCTCCTGG - Intronic
1184502074 22:44880353-44880375 CCAGATCCCCGGGGTGCTCCCGG - Intergenic
1184585466 22:45445056-45445078 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
1184712926 22:46263463-46263485 CGAGGTCCCAGCTGCTCTCTGGG - Intergenic
1185349614 22:50327562-50327584 CCAGGTCCCCGCGATTCCCCCGG - Intergenic
1185387185 22:50539295-50539317 CCAGGGCCCTGCAGTACTCCCGG + Intergenic
949467654 3:4360419-4360441 CCAGGTTCAAGCAATTCTCCTGG + Intronic
949674089 3:6432811-6432833 CCAGGTTCAAGCGATTCTGCTGG - Intergenic
949740026 3:7221898-7221920 CCAGGTTCAAGCAATTCTCCTGG + Intronic
950056631 3:10030188-10030210 CCGGGTTCAAGCGATTCTCCTGG + Intronic
950106109 3:10389851-10389873 CTGGGTCCCAGCTGTCCTCCTGG - Intronic
950235413 3:11315818-11315840 CCTGGTTCAAGCGATTCTCCTGG + Intronic
950642967 3:14360285-14360307 CCTGGTCACATCCGTTCTCCAGG - Intergenic
951060561 3:18201873-18201895 CCAGATTCAAGCGATTCTCCTGG + Intronic
952483043 3:33781415-33781437 CCAGGTTCAAGCGATTCCCCTGG - Intergenic
953212061 3:40884800-40884822 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
953469330 3:43153833-43153855 CCAGATCCCAGCCGCTCCCCCGG + Intergenic
953470591 3:43162843-43162865 CCAGGTCCCAGGGCTACTCAAGG + Intergenic
953756624 3:45652018-45652040 CCAGGTTCCAGCGATTCTCACGG + Intronic
953995325 3:47514703-47514725 CCAGGTTCAAGCGATTCTACTGG - Intergenic
954282724 3:49594982-49595004 CCAGGTTCAAGTGATTCTCCTGG + Intronic
954302612 3:49708078-49708100 CCGGGTTCAAGCAGTTCTCCTGG + Intronic
954455133 3:50593813-50593835 CCAGGTTCAAGCGATTCTCTTGG + Intergenic
954479492 3:50785061-50785083 CCAGGTTCAAGCAATTCTCCTGG - Intronic
954509460 3:51109702-51109724 CCAGGTTCCAGTGGTCCACCTGG - Intronic
955269815 3:57486129-57486151 CCAGGTTCAAGCTATTCTCCTGG - Intronic
955306617 3:57839532-57839554 CCAGGTTCAAGCAGTTCTGCTGG + Intronic
955320255 3:57969488-57969510 CCAGATTCAAGCGATTCTCCTGG - Intergenic
955913832 3:63885921-63885943 CCAGGTTGAAGCGATTCTCCTGG - Intronic
959147297 3:102564767-102564789 CCAGATCCCAGTGGCTCTCAGGG + Intergenic
959197241 3:103200102-103200124 CCAGCTCTCAGAGGTTCTCCTGG + Intergenic
959404898 3:105949331-105949353 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
959473804 3:106785295-106785317 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
959685454 3:109141078-109141100 TCAGGTTCAAGCGATTCTCCCGG + Intergenic
959703773 3:109321681-109321703 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
961182003 3:124885174-124885196 CCAGGTTCAAGCAATTCTCCTGG - Intronic
961262643 3:125614933-125614955 CCAGGTTCAAGTGATTCTCCTGG - Intergenic
961596093 3:128018342-128018364 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
961814135 3:129539772-129539794 CCAGGCCCCAGCCTTGCTCCTGG - Intergenic
961844314 3:129748379-129748401 CCAGGCTCAAGCGATTCTCCTGG + Intronic
961919314 3:130409332-130409354 CCAGGTTCCAGAGGTGCCCCTGG + Exonic
962184236 3:133241707-133241729 CCAGGTTCAAGTGATTCTCCTGG + Intronic
962473312 3:135732485-135732507 CCACGTCAGAGAGGTTCTCCTGG + Intergenic
962800070 3:138882859-138882881 CCGGGTTCAAGCGATTCTCCCGG + Intergenic
963724929 3:148909124-148909146 CCAGGTTCCAGCACTTCTCCTGG - Intergenic
964169430 3:153751892-153751914 CCAGGTTCAAGTGATTCTCCTGG - Intergenic
964797534 3:160516078-160516100 CCAGGTTCAAGCGATTCTCCTGG + Intronic
965124689 3:164611341-164611363 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
965591339 3:170362719-170362741 CCAGGTTCAAGCGATTCTCCTGG - Intronic
965600844 3:170453578-170453600 CCTGGTTCAAGCGATTCTCCTGG + Intronic
966023085 3:175240747-175240769 CCAGGTTCAAGCGATTCTCCTGG + Intronic
966245321 3:177801745-177801767 CCGGGTTCCAGTGATTCTCCTGG - Intergenic
966377046 3:179307076-179307098 CCAGGACCCAGCTATTTTCCTGG + Intergenic
966440827 3:179942476-179942498 CAAGGCCCCAGCGCTTCTGCAGG + Intronic
968029797 3:195474000-195474022 CCGGGTTCAAGCGGTTCTCGTGG + Intergenic
968135758 3:196218274-196218296 CCAAGCCCCATCGGGTCTCCTGG + Intronic
968167583 3:196479682-196479704 CCAGGTTCAAGCAATTCTCCTGG + Intronic
968352148 3:198066773-198066795 CGAGGTTCAAGCGATTCTCCTGG - Intergenic
968502383 4:956964-956986 CCAGGTGCCAGGGATGCTCCAGG + Intronic
969073299 4:4557152-4557174 ACAGGACCCAGGGGATCTCCAGG - Intergenic
969217794 4:5735919-5735941 ACAGCTCCCAGCGGCTCACCAGG - Intronic
969273593 4:6119448-6119470 CCGGGTTCAAGCGATTCTCCTGG - Intronic
969412576 4:7038993-7039015 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
969505006 4:7580394-7580416 CCAGGTTCAAGCGATTCTCATGG - Intronic
970875107 4:20860231-20860253 CCAGGTTAAAGCGATTCTCCTGG + Intronic
971456914 4:26853629-26853651 CCAGGTTCAAGCCGTTCTCCTGG + Intergenic
971567239 4:28160766-28160788 CCAGGTTCAAGCGATTCTTCTGG + Intergenic
971844068 4:31895940-31895962 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
971916663 4:32878917-32878939 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
972340112 4:38145244-38145266 CCAGGGCCCAAGGGTGCTCCAGG + Intergenic
972354023 4:38263827-38263849 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
972595946 4:40530027-40530049 CCGGGTTCAAGCGATTCTCCTGG + Intronic
972779530 4:42274403-42274425 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
972865542 4:43227812-43227834 CCAAGTCCTAGCTGTTTTCCAGG - Intergenic
973152653 4:46907945-46907967 CCGGGTTCAAGCGATTCTCCCGG + Intronic
973320232 4:48802625-48802647 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
973562101 4:52147539-52147561 CCAGGTTCAAGCCATTCTCCTGG + Intergenic
973565873 4:52186945-52186967 CCAGGTCCAGGCAGCTCTCCTGG + Intergenic
974333927 4:60515155-60515177 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
974788425 4:66653170-66653192 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
974810234 4:66936781-66936803 CCAGGTTCAAGCGATTCTTCTGG - Intergenic
974930004 4:68350613-68350635 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
975126258 4:70785740-70785762 CCAGGTTCAAGCAATTCTCCTGG - Intronic
975135947 4:70874648-70874670 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
975136651 4:70881412-70881434 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
975681019 4:76876250-76876272 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
975881115 4:78909150-78909172 CCAGTTTCAAGCGATTCTCCTGG + Intronic
976383965 4:84434025-84434047 CCAAGTCCCAGGTGTCCTCCTGG - Intergenic
976759283 4:88530941-88530963 CCAGGTTCAAGTGATTCTCCTGG + Intronic
977931418 4:102753908-102753930 CCAGGTTCAAGCGATTCTCATGG - Intronic
978569478 4:110120892-110120914 CCGGGTTCAAGCGATTCTCCTGG + Intronic
978574120 4:110171313-110171335 CCAGGTTCAAGCGATTCTCCTGG - Intronic
979231746 4:118354366-118354388 CCAGGTTCAAGCGATTTTCCTGG - Intergenic
979468666 4:121071076-121071098 GCAGGTCCCAGCTGTTTTCTTGG - Intronic
979840100 4:125428202-125428224 CCGGGTTCAAGCGATTCTCCTGG - Intronic
979913758 4:126404623-126404645 CCATGTCCAAGCAGATCTCCAGG + Intergenic
980050875 4:128038814-128038836 CCGGGTTCAAGCGATTCTCCTGG - Intronic
980051376 4:128043568-128043590 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
980144551 4:128965923-128965945 CCAGGTTCAAGTGATTCTCCTGG + Intronic
980752687 4:137112488-137112510 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
980887049 4:138774283-138774305 CCAGGTTCAAGCGATTCTCATGG - Intergenic
980887416 4:138778623-138778645 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
980983238 4:139671733-139671755 CCAGGTTCAAGTGATTCTCCCGG + Intronic
981034557 4:140156147-140156169 CCGGGTTCCAGTGATTCTCCTGG + Intergenic
981334749 4:143558051-143558073 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
981517549 4:145626049-145626071 CCAGGTCCCAGTGCCTCTCTGGG + Intronic
982340507 4:154293294-154293316 CCAGGTTCAAGCGATTCTCCCGG + Intronic
983203428 4:164886917-164886939 CCAGGTTCAAGCAGTTCTCCTGG + Intronic
983281530 4:165686886-165686908 CCAGGTACCAGTGGTTTTGCTGG - Intergenic
983966660 4:173820687-173820709 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
984363763 4:178771551-178771573 CCAGGTGCAAGCAATTCTCCTGG + Intergenic
984826159 4:183926715-183926737 CCGGGTTCAAGCAGTTCTCCTGG + Intronic
985109731 4:186536250-186536272 CCAGGTTCAAGCAATTCTCCTGG - Intronic
985479346 5:98526-98548 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
985569884 5:639148-639170 CCAGGTCCAAGAGCGTCTCCAGG - Exonic
986757513 5:10851952-10851974 CCAGGTCCCTGTGGTTTTACAGG + Intergenic
986939640 5:12935440-12935462 CCAGGTGCAAGCTGTGCTCCTGG + Intergenic
987222251 5:15802745-15802767 CCAGGTTCCAGTGATTCTCCTGG + Intronic
987920056 5:24268120-24268142 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
988604248 5:32666432-32666454 CCAGGACCCATCAGTTCTGCTGG + Intergenic
989641619 5:43588559-43588581 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
990002853 5:50914662-50914684 CCAGGTTCAAACGATTCTCCTGG - Intergenic
990734776 5:58847948-58847970 TCAGGTTCAAGCGATTCTCCTGG + Intronic
990909252 5:60837361-60837383 CCAGGTTCAAGCAATTCTCCTGG - Intronic
991015744 5:61930258-61930280 TCAGGTTCAAGCGATTCTCCTGG - Intergenic
991031973 5:62091755-62091777 CCAGGGCACAGCTGTCCTCCTGG + Intergenic
991149488 5:63350048-63350070 CCAGGTTCAAGTGGTTCTCATGG + Intergenic
991295369 5:65074720-65074742 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
991467222 5:66926451-66926473 CCAGGTACAAGCAATTCTCCTGG - Intronic
991809832 5:70465365-70465387 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
992116496 5:73543145-73543167 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
992240615 5:74765903-74765925 CCGGGTTCAAGCGATTCTCCAGG - Intronic
992254244 5:74905791-74905813 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
992536777 5:77714224-77714246 CCGGGTTCAAGCGATTCTCCTGG - Intronic
992557440 5:77917137-77917159 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
995575494 5:113527882-113527904 CCAGGTTCAAGCGATTCTCCTGG + Intronic
996436235 5:123435442-123435464 CTAGGTTCAAGCGATTCTCCTGG - Intergenic
997461734 5:134057384-134057406 CCAGGTTCTAGCAATTCTCCGGG - Intergenic
997914700 5:137912896-137912918 CCAGGTTCAAGTGATTCTCCTGG + Intronic
998022177 5:138778970-138778992 CCAGGTTCCAGCGATTCTCCTGG + Intronic
998089353 5:139354911-139354933 CCAGGTTCAAGCGATACTCCTGG + Intronic
998110647 5:139499851-139499873 CCAGGTTCAAGTGATTCTCCTGG - Intergenic
998245790 5:140503659-140503681 CCAGGTTAAAGCGATTCTCCTGG + Intronic
998348544 5:141485740-141485762 CCTGGTCCCAGAGCTGCTCCTGG + Exonic
998575455 5:143310749-143310771 CCAGGTTCAAGCAATTCTCCTGG + Intronic
998588131 5:143449647-143449669 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
999444177 5:151625869-151625891 CCAGGTTCAGGCGATTCTCCTGG - Intergenic
1000104594 5:158047272-158047294 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1001045321 5:168366889-168366911 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1001077419 5:168640807-168640829 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1001330448 5:170758832-170758854 CCAGGTTCAAGAGATTCTCCTGG + Intergenic
1001761779 5:174213768-174213790 CCAGGTCCCAGCTTGTCTCCTGG + Intronic
1001930177 5:175667348-175667370 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1002172227 5:177381770-177381792 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1002974311 6:2059080-2059102 CCAGGTTCAAGAGATTCTCCTGG - Intronic
1003245693 6:4380175-4380197 CCTGGTTCCTGCGGCTCTCCTGG + Intergenic
1003404826 6:5819855-5819877 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1003923885 6:10858604-10858626 CCAGGTTCAAGCAATTCTCCTGG - Intronic
1003938410 6:10999467-10999489 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1004556533 6:16703923-16703945 CCAGGTTCAAGCAATTCTCCTGG - Intronic
1004569787 6:16834048-16834070 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
1005970291 6:30755634-30755656 CCTGGTTCAAGCGATTCTCCTGG - Intergenic
1006306207 6:33221109-33221131 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
1006695355 6:35926213-35926235 CCAGGTGGCATTGGTTCTCCAGG - Intergenic
1006777651 6:36608344-36608366 GCAGGTTCAAGCGATTCTCCTGG - Intergenic
1007580809 6:42958839-42958861 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1007580984 6:42960102-42960124 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1008002295 6:46373356-46373378 CCAGGTTCCAGTGATTCTCATGG + Intronic
1009434675 6:63604073-63604095 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1009759981 6:67992924-67992946 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1010207271 6:73334245-73334267 CCCGGTTCAAGCGATTCTCCTGG - Intergenic
1011055962 6:83203691-83203713 CCAGGTTCAAGTGATTCTCCAGG + Intergenic
1011687146 6:89832621-89832643 CCAGGTTCAAGCGATTCTTCTGG + Intronic
1012549661 6:100455368-100455390 CCTGGTCCCTGGGGTCCTCCTGG + Intronic
1013266259 6:108502118-108502140 CCAGGTTCAAGCGATTCTCTTGG + Intronic
1013448167 6:110252048-110252070 CCAGGTCCAAGCAATTCTTCTGG - Intronic
1013980425 6:116121595-116121617 CCAGGACCCAGGGGCTTTCCTGG - Exonic
1014210918 6:118707139-118707161 GCTGGTCCCAGCAGTCCTCCTGG + Intronic
1014276934 6:119398506-119398528 CCAGGACCCATCAGTTCTGCTGG + Intergenic
1015412578 6:132911513-132911535 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
1015941694 6:138458730-138458752 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1016002511 6:139056662-139056684 CCCGGTTCAAGAGGTTCTCCTGG - Intergenic
1016044593 6:139467846-139467868 CCAGGTTCAAGTGATTCTCCTGG - Intergenic
1016269115 6:142268288-142268310 CCAGGTTCAAACGATTCTCCTGG + Intergenic
1016806379 6:148216561-148216583 CCAGATGCCAGCGGTCTTCCTGG - Intergenic
1017141700 6:151196758-151196780 CCTGGTCCCAGCTGTTCTGTGGG - Intergenic
1017531446 6:155296351-155296373 CCAGGTTCAAGCAATTCTCCTGG + Intronic
1017533666 6:155323816-155323838 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1017752648 6:157502782-157502804 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1017824759 6:158073289-158073311 CCAGGTTCAAGCAATTCTCCTGG + Intronic
1017878309 6:158541997-158542019 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1017943524 6:159075053-159075075 CCAGGTCTCCTCGATTCTCCAGG + Intergenic
1018385529 6:163299783-163299805 CCTGGTTCAAGCGATTCTCCTGG - Intronic
1018733567 6:166670912-166670934 CCAGGTTCAAGTGGTTCTCGTGG + Intronic
1019032806 6:169027274-169027296 CCAGGTTCAAGCGATTCTTCTGG + Intergenic
1020162741 7:5784608-5784630 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1020247436 7:6440773-6440795 CCAGGTTCAAGCAGTTCTCCTGG - Intronic
1020510123 7:9046041-9046063 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1020851387 7:13358224-13358246 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
1020947934 7:14638942-14638964 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1022007870 7:26282569-26282591 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
1022108513 7:27213661-27213683 CCCCATCCCAGCTGTTCTCCTGG - Intergenic
1022137256 7:27460480-27460502 CCAGGTTCAAGCAATTCTCCAGG + Intergenic
1022685827 7:32595523-32595545 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1022811062 7:33869482-33869504 CCAGGACCCAGTGGTTGTACTGG - Intergenic
1022889200 7:34678313-34678335 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1023394253 7:39737605-39737627 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1023553360 7:41392675-41392697 TCAGGTCCCAGCGGTTTCACAGG - Intergenic
1025112696 7:56232611-56232633 CCAGGTTGAAGCGATTCTCCTGG - Intergenic
1025140840 7:56462442-56462464 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1025163691 7:56690828-56690850 CCAGGTTCTAGCAATTCTCCTGG - Intergenic
1025722880 7:64032447-64032469 CCAGGTTCAAGAGATTCTCCTGG - Intronic
1025984778 7:66440264-66440286 CTAGGTTCAAGCGATTCTCCTGG + Intergenic
1026358550 7:69581459-69581481 CCAGGTTCAAGCGATTCTTCTGG - Intergenic
1026583178 7:71634658-71634680 CCAGGTTCAAGCAATTCTCCTGG - Intronic
1026763713 7:73146038-73146060 CCAGGTTTCAGCAATTCTCCTGG + Intergenic
1026779792 7:73257861-73257883 CCAGGTTCAAGTGATTCTCCTGG - Intergenic
1026944951 7:74309781-74309803 CCAGGTTCAAGCGATTCTCCCGG - Intronic
1027020645 7:74811274-74811296 CCAGGTTCAAGTGATTCTCCTGG - Intronic
1027040183 7:74955809-74955831 CCAGGTTTCAGCAATTCTCCTGG + Intergenic
1027067380 7:75134657-75134679 CCAGGTTCAAGTGATTCTCCTGG + Intronic
1027083455 7:75246546-75246568 CCAGGTTTCAGCAATTCTCCTGG - Intergenic
1027207991 7:76118853-76118875 CTAGGTTCAAGCGATTCTCCTGG + Intergenic
1028675623 7:93457293-93457315 TCACTTCCCAGCGGTTGTCCTGG - Intronic
1029207407 7:98878161-98878183 CCCGGTCCCCGCTGCTCTCCTGG - Intronic
1029420955 7:100471644-100471666 CCAGGTTTAAGCGATTCTCCTGG - Intronic
1029507084 7:100969042-100969064 CCAGTTTCCAGCCCTTCTCCTGG - Intergenic
1029807338 7:103010682-103010704 CCATGTTCCAGTGGTTCTCCTGG + Intronic
1029811385 7:103052848-103052870 CCAGGTTCAAGTGATTCTCCTGG + Intronic
1030032450 7:105382072-105382094 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1030301397 7:107977683-107977705 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1030306144 7:108020375-108020397 CCAGGTTCAAACGATTCTCCTGG - Intergenic
1031881496 7:127203612-127203634 CCTGGTTCAAGCGATTCTCCTGG - Intronic
1031965105 7:128022109-128022131 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1032013057 7:128359527-128359549 CCAGGTCACAGTGCTCCTCCTGG + Exonic
1033083601 7:138321366-138321388 CCAGGTTCAAGCGATCCTCCTGG - Intergenic
1034120143 7:148619639-148619661 CCAGGTTCCAGCGAATCTCCTGG - Intergenic
1034354082 7:150437413-150437435 CCAGGTTCAAGTGATTCTCCCGG + Intergenic
1034405986 7:150902772-150902794 GCAGGTCCCTGCCCTTCTCCAGG - Intergenic
1034531602 7:151699310-151699332 CCTAGTCCCAGCAGATCTCCGGG + Intronic
1034548732 7:151806870-151806892 CCAGGTTCAAGCGATTCTCGTGG - Intronic
1035587424 8:786599-786621 CCAGGAACCAGCGGCTCTTCGGG + Intergenic
1036143713 8:6232473-6232495 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1036492734 8:9242912-9242934 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
1036501611 8:9319506-9319528 CCAGGTGCCCGCGGTCCGCCCGG + Intergenic
1036531656 8:9595212-9595234 CCAGGTTCAAGCAATTCTCCTGG + Intronic
1036814680 8:11892795-11892817 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1037679294 8:21080702-21080724 CCAGGTTCAAGCGAGTCTCCTGG - Intergenic
1038076098 8:24076762-24076784 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1038288282 8:26225912-26225934 CCAGGTTCAGGCGATTCTCCCGG + Intergenic
1038552931 8:28485264-28485286 CCAGGTTCAAGCGCTTCTCCTGG + Intronic
1038809912 8:30829724-30829746 CCAGGTTCAAACGATTCTCCTGG - Intergenic
1039449503 8:37660509-37660531 CCAGGTCCCCCTGGCTCTCCAGG + Intergenic
1039514052 8:38116437-38116459 CCAGGTTCAAGCGATTCTCTTGG - Intronic
1039541183 8:38372588-38372610 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1039648766 8:39317496-39317518 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
1040408312 8:47131063-47131085 CCAGGTTCAGGCGATTCTCCTGG - Intergenic
1040504069 8:48031113-48031135 CCAGGTTCAAGTGCTTCTCCTGG - Intronic
1040655920 8:49507067-49507089 CCAGGTTCAAGCTATTCTCCTGG - Intergenic
1040847902 8:51863831-51863853 CCAAGTTCAAGCAGTTCTCCTGG - Intronic
1042927311 8:73979125-73979147 CCATGTTCAAGCGATTCTCCTGG + Intronic
1043966827 8:86487492-86487514 CCAGGTTCAAGCGATTCTTCTGG - Intronic
1044734922 8:95269240-95269262 CCAGGTCCCCTCGTTACTCCTGG - Intergenic
1044840296 8:96331433-96331455 CCAGGTTCATGCGATTCTCCTGG - Intronic
1045210929 8:100099007-100099029 CCAGGTTCAAGCGATTATCCTGG + Intronic
1045280631 8:100746790-100746812 CCAGGTTCAAGCGATTCCCCTGG + Intergenic
1045963038 8:107991151-107991173 CCAGGTTCAGGCAGTTCTCCTGG - Intronic
1047700173 8:127441832-127441854 CCAGGTTCCAGTAATTCTCCTGG - Intergenic
1048250290 8:132860670-132860692 CCAGGTTCAAGCGATTCTTCTGG + Intergenic
1048856513 8:138690828-138690850 CCCGGTCCCAGTGGCCCTCCAGG - Exonic
1049036430 8:140079834-140079856 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1049170938 8:141160270-141160292 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1049524870 8:143119046-143119068 TCAGGTTCAAGCGATTCTCCTGG + Intergenic
1049611994 8:143560167-143560189 CCAGGTCCCAGCCTTGCTCTTGG + Intronic
1049648648 8:143752057-143752079 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1049680768 8:143917011-143917033 CCAGGACCCAGCTGGCCTCCTGG - Exonic
1050520171 9:6488904-6488926 CCAGGTTCAAGTGATTCTCCTGG + Intronic
1050631228 9:7560835-7560857 CCAGGTCCTAGGGGTCCTTCTGG + Intergenic
1051450908 9:17196115-17196137 CCAGGTTCAAGCAGTTCTCCTGG + Intronic
1052007685 9:23368773-23368795 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1053620533 9:39809803-39809825 CCGGGTCCCAGCGGAGCGCCCGG - Intergenic
1053626171 9:39874131-39874153 CCGGGTCCCAGCGGAGCGCCCGG + Intergenic
1053878703 9:42569101-42569123 CCCGGTCCCAGCGGAGCGCCCGG - Intergenic
1054217717 9:62376570-62376592 CCGGGTCCCAGCGGAGCGCCCGG - Intergenic
1054232985 9:62532594-62532616 CCCGGTCCCAGCGGAGCGCCCGG + Intergenic
1054263627 9:62897640-62897662 CCGGGTCCCAGCGGAGCGCCCGG + Intergenic
1054723919 9:68631205-68631227 CCAGGACCCAGAGCTGCTCCAGG - Intergenic
1054950448 9:70845331-70845353 CCAGGTTCAAGCAATTCTCCTGG + Intronic
1054994454 9:71369595-71369617 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1055431667 9:76250206-76250228 CCAGGTTCAAGTGATTCTCCTGG - Intronic
1056367598 9:85921171-85921193 CCAGGTTCAAGCGATTCTCATGG + Intergenic
1057184749 9:93050819-93050841 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1057207591 9:93183033-93183055 CCAGTGCCCAGCGGGGCTCCAGG + Intergenic
1057885885 9:98829280-98829302 CCAGGTTCAAGTGATTCTCCTGG + Intronic
1057892039 9:98876781-98876803 CCAGGTGCAAGTGATTCTCCTGG + Intergenic
1058030806 9:100195579-100195601 CCAGGTTCAAGCAATTCTCCTGG + Intronic
1058617777 9:106851916-106851938 CCAGATTCAAGCGATTCTCCTGG - Intergenic
1058997241 9:110311980-110312002 CCAGGTTCAAGCAGTTCTCCAGG + Intronic
1059447940 9:114350691-114350713 CCAGTTCCCAGCGTTTCTGTGGG - Intronic
1059592327 9:115675072-115675094 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
1059646160 9:116270084-116270106 ACAGGTCCCAGCTGGTCTCTGGG + Intronic
1059936531 9:119316995-119317017 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1060009608 9:120032033-120032055 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1060120791 9:120987542-120987564 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1060231920 9:121831604-121831626 CCAGGTTCAAGTGATTCTCCTGG - Intronic
1060325380 9:122609632-122609654 CCAGGTCCTGGCTGCTCTCCTGG + Intergenic
1060715136 9:125919305-125919327 CCAGGTTCAAGCAATTCTCCTGG + Intronic
1061012812 9:127965470-127965492 CCAGGTTCCAGCTGTGCTCCTGG + Intronic
1061026090 9:128050739-128050761 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1061028785 9:128067381-128067403 CCGCCTCCCAGCGCTTCTCCGGG + Intronic
1061204927 9:129157333-129157355 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
1061407650 9:130401415-130401437 CCAGGTTCAAGGGATTCTCCTGG + Intronic
1061435802 9:130561059-130561081 TCAGGTTCAAGCGATTCTCCTGG - Intergenic
1061626933 9:131846127-131846149 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1061797460 9:133095758-133095780 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1062446329 9:136596905-136596927 CCAGGTCCCAGTGGGCCCCCAGG + Intergenic
1062489418 9:136797912-136797934 CCGGGTTCGAGCGATTCTCCTGG + Intronic
1062534410 9:137015202-137015224 CCAGGCCCCAGCAGGTATCCTGG + Intronic
1203489536 Un_GL000224v1:90358-90380 CCAGCTCCCAGGGTATCTCCTGG - Intergenic
1203502157 Un_KI270741v1:32246-32268 CCAGCTCCCAGGGTATCTCCTGG - Intergenic
1185507837 X:643069-643091 CCAGGTCCCCAAGGCTCTCCCGG - Intronic
1185507953 X:643449-643471 CCAGGTCCCCAAGGCTCTCCCGG - Intronic
1185508053 X:643750-643772 CCAGGTCCCCAAGGCTCTCCCGG - Intronic
1185758922 X:2674389-2674411 CCAGGTTCTAGCAATTCTCCTGG + Intergenic
1187351543 X:18522887-18522909 CCAGGTTCAAGCCATTCTCCTGG + Intronic
1187424135 X:19161773-19161795 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
1187470585 X:19566016-19566038 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1187929474 X:24280789-24280811 CCAGGTTCAAGCCATTCTCCTGG - Intergenic
1188007569 X:25026613-25026635 CCAGGCCCCAGAGCCTCTCCTGG + Intergenic
1188349691 X:29112891-29112913 CCAGGTTCAAGCAGTTCTCTGGG + Intronic
1188825324 X:34825121-34825143 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1189268170 X:39731960-39731982 ACAAGTCCCAGCCCTTCTCCAGG + Intergenic
1189323674 X:40100603-40100625 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1189472879 X:41327831-41327853 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1189810086 X:44773716-44773738 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1190127210 X:47717166-47717188 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1190168355 X:48091917-48091939 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
1190168888 X:48095768-48095790 CCAGGTTCAAGCAATTCTCCTGG + Intergenic
1190238817 X:48640350-48640372 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1190396484 X:49990256-49990278 CCGGGTCCAAGCAATTCTCCTGG + Intronic
1190396526 X:49990529-49990551 CCAGGTTCAAGCAATTCTCCTGG + Intronic
1190617235 X:52246823-52246845 CCAGGTTCAAGCGATTCTCCAGG + Intergenic
1192457422 X:71288483-71288505 CCAGGTTCAAGTGATTCTCCTGG + Intronic
1193595574 X:83440481-83440503 CCAGGTTCAAGCGATTCCCCTGG - Intergenic
1194177093 X:90664584-90664606 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1194509105 X:94770268-94770290 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1194530948 X:95047456-95047478 CCAGGTTCCAGTGATTCTTCTGG - Intergenic
1196345373 X:114649707-114649729 CCAGGTTCAAGCAATTCTCCTGG + Intronic
1196457929 X:115903090-115903112 CCATGTCCCAGAGTTTCTCTTGG - Intergenic
1196648004 X:118139143-118139165 CAAGGTTCAAGCGATTCTCCTGG + Intergenic
1196741000 X:119025782-119025804 CTGGGTTCCAGCGATTCTCCTGG - Intergenic
1196829758 X:119766776-119766798 CCGGGTTCAAGCGATTCTCCCGG + Intergenic
1198454442 X:136802111-136802133 CCAGGTTCACGCGATTCTCCTGG + Intergenic
1198469257 X:136930577-136930599 CCAGGTTCAAGCAATTCTCCTGG - Intergenic
1198477817 X:137012430-137012452 CCAGGTTCAAGTGATTCTCCTGG + Intergenic
1198612390 X:138416612-138416634 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1198716135 X:139559436-139559458 CCAGGTTCAAGCAATTCTCCTGG - Intronic
1199883909 X:151999844-151999866 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1200168353 X:154052851-154052873 CCAGGTTCAAGTGATTCTCCTGG + Intronic
1200407120 Y:2823704-2823726 CCAGGTTCAAGCAATTCTCCAGG + Intergenic
1200523764 Y:4246733-4246755 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1201938281 Y:19431381-19431403 CCAGGACCCATCGGTCCTGCTGG + Intergenic
1202030655 Y:20570832-20570854 CCAGGTACAAGTGATTCTCCTGG - Intergenic
1202597800 Y:26561443-26561465 CCAGGTTCAAGCGATTCTCCTGG + Intergenic