ID: 943525358

View in Genome Browser
Species Human (GRCh38)
Location 2:189009267-189009289
Sequence AAAGCTGCTTAGATTAGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943525358 Original CRISPR AAAGCTGCTTAGATTAGAAT GGG Intronic
900688979 1:3968147-3968169 AAAGATAGTTAGGTTAGAATAGG + Intergenic
902121967 1:14173903-14173925 AGAGCTGCTTTTATTAGAAGAGG + Intergenic
905936398 1:41827571-41827593 ACAGCTGCTTTGGTTAGGATGGG - Intronic
906092549 1:43193745-43193767 AAAGAAGCTGAGGTTAGAATGGG + Intronic
906580304 1:46930353-46930375 AAACCTGCTCAGATCAGAATGGG - Intronic
906603420 1:47148537-47148559 AAACCTGCTCAGATCAGAATGGG + Intronic
910115794 1:83730379-83730401 AAATCTGTTTTTATTAGAATAGG + Intergenic
911423671 1:97679094-97679116 AAAGCTGCTTTCATTGGAATAGG - Exonic
916357764 1:163932336-163932358 CAAACTGCTTAGATAATAATTGG + Intergenic
920200097 1:204254706-204254728 AAAAATGCTTAGAATAGTATGGG + Intronic
920225835 1:204438360-204438382 AAAGAAGATTAGATTAGAAGTGG - Intronic
921404676 1:214765511-214765533 AAAGCTGCTTAGAGAAGTAGGGG - Intergenic
923884770 1:238142138-238142160 AAATATGCCTAGATTAGAGTAGG + Intergenic
1063622699 10:7663949-7663971 AAAACTGCTTTGATAATAATGGG + Intronic
1063794681 10:9499781-9499803 AAAGCAGCTTCAAATAGAATTGG - Intergenic
1065735996 10:28753007-28753029 AAAGCTGCTATGTTGAGAATGGG + Intergenic
1065883130 10:30054643-30054665 AATGCTGCTTAGGTTAGATGAGG + Intronic
1069029889 10:63584327-63584349 AAACCTGCTTAGATGGGCATGGG + Intronic
1069201429 10:65621930-65621952 AAAGCACCTTAGTTTAGAAAAGG - Intergenic
1070449044 10:76539332-76539354 AAATCTGCCTAGATGATAATAGG + Intronic
1070683491 10:78465314-78465336 AAAGATGATTAGATTAGAAGAGG + Intergenic
1071162002 10:82758069-82758091 AAAGCTGCTTTGTTTTGACTAGG - Intronic
1071192620 10:83119991-83120013 AAAGATGCTAAGATTAAAAGTGG + Intergenic
1071800882 10:89058588-89058610 AAAGCTGCTTTGAACAAAATTGG - Intergenic
1074220013 10:111427276-111427298 AAAGCTGCTTATATAAAAAGAGG + Intergenic
1074661355 10:115661624-115661646 AAATCTGTTTACATTAGATTAGG + Intronic
1075256726 10:120931179-120931201 AAAGCTGGTTAGAGTGGAAGTGG - Intergenic
1078409295 11:11098653-11098675 AAAGCTGCTTAGAGGAGGCTTGG - Intergenic
1078803420 11:14670552-14670574 AGAGTTGCTTGAATTAGAATAGG + Intronic
1079353321 11:19711924-19711946 AGAACTGCTTGGATTAGAAGTGG - Intronic
1082197781 11:49325082-49325104 AAAGCTTCAAAAATTAGAATTGG - Intergenic
1085736923 11:79046977-79046999 AAATATGTATAGATTAGAATGGG - Intronic
1085847567 11:80083484-80083506 TAAACTACTTAGATTAGAGTGGG - Intergenic
1086658037 11:89383045-89383067 AAAGCTTCAAAAATTAGAATCGG + Intronic
1087184138 11:95168816-95168838 AAAGCTGCTTAGACCAAGATGGG + Exonic
1087787994 11:102376250-102376272 ACTGCTACCTAGATTAGAATAGG + Intronic
1087938638 11:104065556-104065578 AAAACTTCTTAAAATAGAATTGG + Intronic
1088284932 11:108178162-108178184 AAAGCTGAATAGATAAGGATTGG - Intronic
1088603661 11:111508267-111508289 AAAGTAGCATAGATTAGAAGAGG - Intronic
1090034977 11:123241413-123241435 AAAGCTCCTTAGAACAGAACAGG - Intergenic
1091578150 12:1759014-1759036 AAAGCTGCCTTTATGAGAATTGG + Intronic
1092389866 12:8067035-8067057 AAAGCTGCTTAGGCTATAAGTGG + Intergenic
1093169983 12:15849500-15849522 AAAGTTGCACTGATTAGAATTGG - Intronic
1093315148 12:17640169-17640191 ACAACTGCTTAGATTAGGAAAGG - Intergenic
1094392456 12:29966319-29966341 TAAGCAGTTTAGATTAGATTTGG - Intergenic
1095159686 12:38902477-38902499 AAAGCAGCTCAGATTTGAATAGG - Intronic
1096480743 12:51939181-51939203 TAGGCTGCTTAGAGTAGAGTAGG + Intergenic
1098634774 12:72768916-72768938 AAAGCTTCTGAGAATATAATTGG + Intergenic
1099623880 12:85042240-85042262 AAATCAGATTAGATTAGATTAGG - Intronic
1099690154 12:85941748-85941770 ACAGATGCAGAGATTAGAATTGG + Intergenic
1100977366 12:100136418-100136440 CATGCTTCTTATATTAGAATAGG + Intronic
1103144149 12:118579752-118579774 AAAAATCCTTATATTAGAATAGG + Intergenic
1106906118 13:34410979-34411001 AAAGCTGAATAGATTGGAGTTGG + Intergenic
1108236712 13:48415908-48415930 AAAAATTCTTAGGTTAGAATTGG + Intronic
1108900964 13:55407906-55407928 AAAGGTTCTTACATTAGATTTGG - Intergenic
1110061359 13:71042212-71042234 AAAGCTGTTTATATTACCATAGG - Intergenic
1110474232 13:75894719-75894741 AAACCTGCTTAGATTTCAACTGG - Intergenic
1112513943 13:100035222-100035244 ACAACTGCATAGCTTAGAATTGG - Intergenic
1116299722 14:43162614-43162636 AATTCTCCTAAGATTAGAATTGG - Intergenic
1117174282 14:53131341-53131363 AAGGCTGATTAGATTTTAATGGG - Intronic
1117235286 14:53768017-53768039 GAAGCTGAATAGGTTAGAATAGG - Intergenic
1118373287 14:65155882-65155904 AAAGCTGCTTATAGTTGAAATGG + Intergenic
1118548548 14:66922215-66922237 AAAGCTCCTTAGTTTAAATTAGG - Intronic
1124090241 15:26592697-26592719 AAAGCTTCTTACATTTTAATGGG + Intronic
1126504810 15:49392459-49392481 AAAACTGATTAGATTTGCATGGG + Intronic
1127343782 15:58072818-58072840 AAAGCTCCCTAAATTACAATTGG - Intronic
1138310772 16:56021895-56021917 GATGATTCTTAGATTAGAATTGG - Intergenic
1138543904 16:57705262-57705284 AGAGCTGCCTAGCATAGAATGGG - Intronic
1150618350 17:66789496-66789518 AAAGCTGACAACATTAGAATTGG - Intronic
1150879585 17:69008696-69008718 AAAACTGTTTAGGTTGGAATCGG + Intronic
1151098455 17:71527199-71527221 GAAGCTGCGTACATTAGAATAGG - Intergenic
1151706108 17:75768792-75768814 AAAGCTGTTAAGAAAAGAATGGG + Intergenic
1153719270 18:7885002-7885024 AAAGCTGCATAGATTTGGAAGGG - Intronic
1156139342 18:34086823-34086845 AAAATTTCTTAGAGTAGAATAGG + Intronic
1156599068 18:38582864-38582886 AAAGCTACTTAGATTAGAAGAGG + Intergenic
1157487544 18:48099358-48099380 AAAGATGCTTAGTATATAATAGG + Intronic
1159424524 18:68268097-68268119 AAAGTTATTTAGATTATAATGGG + Intergenic
1159791152 18:72780451-72780473 AAATCTGCATAGATAAGAAATGG - Intronic
1162457929 19:10797014-10797036 TAAGCTTCTTCGATTAGAAAAGG + Intronic
1163404844 19:17115808-17115830 AAAGCTGCTTTCATTACATTTGG - Intronic
925073095 2:986901-986923 ATAGCTTTTTAGATTAAAATGGG + Intronic
925731111 2:6919800-6919822 AGAGTTGCTGACATTAGAATCGG - Intronic
926667933 2:15545196-15545218 AAAGATGCTTATATTAGAATAGG + Intronic
928928694 2:36601985-36602007 AAAGGTGATTAGATTTTAATGGG - Intronic
930016815 2:46976428-46976450 AGAGCAGCATAGATTAGGATTGG + Intronic
930315829 2:49795976-49795998 AAAGCTGATTCCATTATAATGGG - Intergenic
934106761 2:88702311-88702333 AAGGTTGCTTACATTAGAAAGGG - Intronic
935377594 2:102415719-102415741 AACTCTGCTTAGGTTAGAATAGG - Intergenic
936786075 2:116095263-116095285 ATAGCCCCTTAGATTAGCATAGG - Intergenic
938085785 2:128400803-128400825 AAATCTGCTTTCATTAGAGTTGG + Intergenic
938186073 2:129233093-129233115 AAAGCTGCTGAGAGGCGAATAGG + Intergenic
939208848 2:139145078-139145100 AAAACTGCTAAATTTAGAATGGG + Intergenic
942100810 2:172581414-172581436 AAAGCTGTTTAAAATAAAATAGG + Intronic
942512362 2:176716196-176716218 AAAGCGACTTAGATTGGCATGGG - Intergenic
942553598 2:177147922-177147944 AGAGCTGCTTTAATTAAAATCGG - Intergenic
942948277 2:181694009-181694031 AAAGCTGCTTAGGGTAAAAATGG + Intergenic
943525358 2:189009267-189009289 AAAGCTGCTTAGATTAGAATGGG + Intronic
943815728 2:192251619-192251641 AATGCTGCTCAAATCAGAATTGG - Intergenic
947829968 2:233132685-233132707 CAAACTGCTTTGATTAGAATAGG + Intronic
948336798 2:237214813-237214835 AAAGCTGATTAAATTAGTAATGG + Intergenic
1169812005 20:9617861-9617883 AGAGCTGTTCAGATAAGAATTGG - Intronic
1170051913 20:12155525-12155547 AAAGCTGCTTAGAAGAGGAAAGG - Intergenic
1170174581 20:13454482-13454504 TATGCTGCTTAGAGTAGAAGTGG + Intronic
1172613289 20:36267123-36267145 AAAGCTGCCTACAATGGAATGGG + Intronic
1173901448 20:46592671-46592693 AAGGGTGCTTCTATTAGAATTGG - Intronic
1178091768 21:29171246-29171268 CATGCTGTTTAGAATAGAATAGG - Intronic
1179201935 21:39232518-39232540 AAAGTTTCTTAGATTAGAAAGGG + Intronic
1185144196 22:49121007-49121029 AAGGATGCTTGGAATAGAATGGG + Intergenic
949493238 3:4609126-4609148 AATGGTGATTAGATTAGAAGAGG - Intronic
950617842 3:14176735-14176757 AAAACTGGGTAGATTAGACTAGG - Intronic
951231119 3:20180725-20180747 AAAGATAATTAAATTAGAATTGG - Intronic
953875411 3:46663852-46663874 AAAGCAGCATAGAATAGAAGAGG + Intergenic
953936391 3:47047371-47047393 AAATCTGCTTAAATAAGAAGAGG + Intronic
958519490 3:95166389-95166411 AACCCTGCATAGATTGGAATTGG - Intergenic
960141261 3:114153803-114153825 AAAGGTGCTGAGACTAGAATGGG - Intronic
962334727 3:134516917-134516939 AAAGCTGCTTAGATGAAATCTGG + Intronic
962607098 3:137041617-137041639 AAAGCTGCTTAGGGCAGAAATGG - Intergenic
963098031 3:141566507-141566529 TAAGGTCCATAGATTAGAATTGG - Intronic
964507082 3:157411331-157411353 ATAGCAGCTTAGAGTAGCATTGG - Intronic
964586256 3:158306649-158306671 GAAGATGATTAGATTAGAAAAGG + Intronic
965627161 3:170692745-170692767 AAAGCTGCTGACATGAGAAAAGG - Intronic
967365462 3:188681469-188681491 AAAGCTGCTTATCTTAGAGAAGG - Intronic
969060382 4:4429381-4429403 AAAGAGGATTAGATTAGAAAAGG - Intronic
970601252 4:17642446-17642468 AAAACTGCTGAGCTAAGAATGGG + Intronic
971936018 4:33148559-33148581 AAAGCAGCTGAGATTTGAATAGG - Intergenic
974933205 4:68383668-68383690 AATTCTGCTTAAATTAGAATTGG + Intergenic
975327263 4:73072703-73072725 AAAGCTACCTAATTTAGAATTGG + Intergenic
975408343 4:74018140-74018162 AAAGAAGCTTAGATGAGAAATGG + Intergenic
978399742 4:108317945-108317967 AAAGCACCTTATATTATAATTGG + Intergenic
979595763 4:122532420-122532442 AAAGCTGATTAGTTTCGAGTAGG - Intergenic
980439976 4:132829711-132829733 AAAGAAGGTTAGATTAGACTGGG - Intergenic
980889250 4:138796589-138796611 AAAGCTTCTTAAAAGAGAATAGG - Intergenic
982348870 4:154392607-154392629 AAAGCTGCTAAATTGAGAATAGG - Intronic
985371245 4:189287210-189287232 AAAGCTGCTTTGATTTGATTGGG - Intergenic
987137473 5:14913233-14913255 AAAGCTGCATAGGTTTGAAGTGG + Intergenic
987720795 5:21629635-21629657 AAAGGAGATTAGATTTGAATTGG + Intergenic
988382954 5:30522805-30522827 AAAGCTCTTTAAGTTAGAATGGG + Intergenic
990362459 5:55034480-55034502 ATAGAAGCTTAGAGTAGAATGGG - Exonic
997281536 5:132651041-132651063 AACACTGGTGAGATTAGAATAGG + Intergenic
997603001 5:135153199-135153221 AAAGCTGCTTTGGTTAAAATGGG + Intronic
1000166334 5:158652732-158652754 AAAGGATTTTAGATTAGAATCGG - Intergenic
1000378219 5:160603990-160604012 CAAGCTGCTGATATTGGAATTGG - Exonic
1001567686 5:172711131-172711153 ATGGCTGCTTAGATAAGGATGGG - Intergenic
1003680556 6:8249365-8249387 AAGGCTTGTGAGATTAGAATTGG - Intergenic
1003751945 6:9068745-9068767 AAAGGTGATTAGGTTACAATGGG - Intergenic
1004589653 6:17036937-17036959 AAAGCTTCTTAGCTTACTATTGG - Intergenic
1005740746 6:28788270-28788292 AAACCTGCTTAGCTGAGGATTGG - Intergenic
1008232403 6:48998549-48998571 AAAACTCCTTAGATTAGAAGTGG - Intergenic
1009298125 6:61980515-61980537 AAAGCTGGCTACATTTGAATGGG + Intronic
1009571298 6:65389013-65389035 ACAGTGACTTAGATTAGAATTGG - Intronic
1010051679 6:71511893-71511915 AAAGCTGCTTTGCTAAGACTGGG + Intergenic
1010498946 6:76570598-76570620 AAATCTGCTCAGAGTAGATTTGG + Intergenic
1011998645 6:93624730-93624752 AAAGCAGCATAGAGAAGAATGGG + Intergenic
1012335278 6:98047785-98047807 AAAGCTGCTCAGAGAAGAAGCGG - Intergenic
1016287080 6:142485588-142485610 AAAGATGCCAAGTTTAGAATTGG + Intergenic
1016595420 6:145792418-145792440 AAAGCAGATGAGATCAGAATTGG + Intergenic
1023323593 7:39027535-39027557 AGAGCTGCTCTGATTGGAATTGG - Intronic
1024562892 7:50659576-50659598 ACAGCTGCTTAGCTCAGCATGGG - Intronic
1027448431 7:78301723-78301745 AAAGCTGCTGAGATTGGTATTGG - Intronic
1028283297 7:88961132-88961154 AAAGCTTTTTGGAATAGAATTGG - Intronic
1032614491 7:133452201-133452223 AATACAGCTTAGATTAGAAATGG + Intronic
1034082880 7:148296792-148296814 AGAGCTGCTTTGTTTAGATTAGG - Intronic
1034483262 7:151340007-151340029 AAAGCTGCTGAGGCAAGAATGGG - Intergenic
1035590590 8:810200-810222 AAAGCTGCAAAGATTAGAAGTGG - Intergenic
1035665509 8:1377042-1377064 CTGGCTGCTTACATTAGAATAGG + Intergenic
1036615369 8:10383421-10383443 GAAGCTGCTTGAGTTAGAATAGG - Intronic
1038782311 8:30578747-30578769 AAAGCTTATTTGAGTAGAATGGG - Exonic
1039222921 8:35355445-35355467 AATGATGGTTAGATTATAATAGG - Intronic
1040789526 8:51209778-51209800 AAAGGTGCTTAATTTAGAAAAGG + Intergenic
1047764105 8:127976458-127976480 AGAGCTGCTTTGATAAAAATAGG + Intergenic
1048673567 8:136751008-136751030 AAATCTGCTGATAGTAGAATTGG + Intergenic
1053044663 9:34905311-34905333 AAGGCGGCTTAGATGAGAAATGG - Intergenic
1054923485 9:70565079-70565101 ACAGCTGCTTAGATTCTAAGCGG - Intronic
1057064005 9:92031827-92031849 AAGGATGCTCAGATTAGAAATGG + Intergenic
1057424557 9:94937725-94937747 ACAGCAGCTTACATTAGGATAGG - Intronic
1057454247 9:95193173-95193195 CATGCTGATTAGATTAGAAATGG + Intronic
1059011156 9:110461922-110461944 AAACTTGCTTAGCTTAAAATGGG + Intronic
1061657023 9:132100027-132100049 AAGGATGCATAGATTAGAAGGGG - Intergenic
1185865726 X:3622188-3622210 CAAGCTGCTTCAATTAGGATGGG + Intronic
1186655951 X:11612378-11612400 ACAGCTGTTTAGATCAGAAGTGG - Intronic
1188183591 X:27087028-27087050 AAAGCTTTTTAGATATGAATAGG - Intergenic
1188194052 X:27208730-27208752 AAAGCTTCATACATTTGAATAGG - Intergenic
1189021303 X:37344073-37344095 AAGTCTGCTTGGATTATAATTGG + Intergenic
1190143685 X:47871029-47871051 AAAGTTTCTTGTATTAGAATTGG + Intronic
1190651193 X:52570405-52570427 AAAGCTGCTAAGATCTTAATGGG - Intergenic
1192533377 X:71908647-71908669 AAAGCTGGTTTGCTTGGAATTGG + Intergenic
1193601679 X:83514191-83514213 AAATATGCTTAAATTAGTATAGG + Intergenic
1196627853 X:117898112-117898134 AAAGCAGCTTCCATTAAAATGGG - Exonic
1199522113 X:148747954-148747976 AAATCTGCTTAAGTTAGAAATGG + Intronic
1199603991 X:149561952-149561974 AAAGCTGCATAGATAGGACTCGG - Intergenic
1199646398 X:149917522-149917544 AAAGCTGCATAGATAGGACTCGG + Intergenic
1199702452 X:150392569-150392591 ACATCTGCTTACATGAGAATTGG + Intronic
1199915602 X:152336846-152336868 GAAGCTGTTTAAAATAGAATTGG - Intronic
1200798076 Y:7360160-7360182 CAAGCTGCTTCAATTAGGATGGG - Intergenic
1201578433 Y:15485636-15485658 ACAGTTGCTTAGTTTAGATTTGG + Intergenic