ID: 943525869

View in Genome Browser
Species Human (GRCh38)
Location 2:189016693-189016715
Sequence ACAGATATTCAAAACTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943525869_943525870 20 Left 943525869 2:189016693-189016715 CCATCAAAGTTTTGAATATCTGT No data
Right 943525870 2:189016736-189016758 GCTTTTAAAGAGATCATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943525869 Original CRISPR ACAGATATTCAAAACTTTGA TGG (reversed) Intergenic
No off target data available for this crispr