ID: 943527550

View in Genome Browser
Species Human (GRCh38)
Location 2:189036678-189036700
Sequence TGTACCACGTAAAACCTGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 46}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943527550 Original CRISPR TGTACCACGTAAAACCTGGT GGG (reversed) Exonic
907760191 1:57350288-57350310 TACACCACGTAAAAGCTGGTGGG - Intronic
924812241 1:247413336-247413358 GGTACCACCTCAAACCTGTTAGG - Intergenic
1063020966 10:2127257-2127279 TGTACCACGCAGTAACTGGTGGG + Intergenic
1063301937 10:4857262-4857284 TGTTGGAGGTAAAACCTGGTGGG + Intergenic
1068650006 10:59512237-59512259 TGTACCACATAAAAAATGTTGGG - Intergenic
1075190011 10:120298545-120298567 TGGAGCACTTAAAAGCTGGTAGG + Intergenic
1077457124 11:2687877-2687899 TGTCCCGCGGAAATCCTGGTGGG + Intronic
1079646822 11:22874133-22874155 TCTAACACGCAAAACCAGGTAGG - Intergenic
1105444168 13:20438202-20438224 CTTAGCACATAAAACCTGGTGGG + Intronic
1108607021 13:52049869-52049891 TGTACCTCCTGATACCTGGTGGG - Intronic
1110330782 13:74270081-74270103 TGTATAACATAAAACTTGGTTGG + Intergenic
1110477410 13:75932694-75932716 TCTACCACATAAAACCAGGAAGG - Intergenic
1112154462 13:96802219-96802241 TGAATCACGTAAATCCTGATAGG - Intronic
1135266280 16:21028696-21028718 TGTAGCAAGTAAAACCCTGTAGG + Intronic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1156670087 18:39458501-39458523 TGTTGGAGGTAAAACCTGGTGGG + Intergenic
1167935194 19:52900131-52900153 TGTATCTGGTATAACCTGGTGGG + Intergenic
925012985 2:499942-499964 TGTAACACAGGAAACCTGGTCGG - Intergenic
926629054 2:15120150-15120172 TGTACCTCTTAAAACCTGTCTGG + Intergenic
932333024 2:70910012-70910034 TGGAACATGTAAAACCAGGTGGG + Intronic
941269532 2:163408153-163408175 TGTGCCAGGTCAAAACTGGTGGG + Intergenic
943527550 2:189036678-189036700 TGTACCACGTAAAACCTGGTGGG - Exonic
945909751 2:215635309-215635331 TGTTCCAAGTAATACCTGGATGG - Intergenic
1170016748 20:11790320-11790342 TAAACCACCTAAAACCTGCTGGG + Intergenic
1172802627 20:37588235-37588257 TGTACCACTTTATACCTAGTAGG + Intergenic
1182049621 22:27302747-27302769 TGTACCTCCTAAAACCTGGTGGG + Intergenic
949354431 3:3163259-3163281 TGTATCACCTAAAACCTTTTAGG + Intronic
951194817 3:19812424-19812446 AGAACCACTTAAAACATGGTTGG - Intergenic
953366494 3:42350036-42350058 TGTATCAGGTAAAATCTGGCCGG - Intergenic
959321546 3:104882108-104882130 TCCACCAAGTAAAAGCTGGTGGG + Intergenic
969633882 4:8353974-8353996 GGAACCACCTAAAACCTGGAGGG + Intergenic
970292786 4:14593540-14593562 TGGAGCACGTAAGACCTTGTAGG + Intergenic
979786244 4:124718518-124718540 TGTATCACATAAAACCAGGATGG - Intergenic
981670122 4:147277148-147277170 TATACCACATACAACCTGGGAGG - Intergenic
984731616 4:183073770-183073792 TGTCCCAGGTAAAACCCGGATGG + Intergenic
985100503 4:186453505-186453527 TGAACCACTAAAAAGCTGGTTGG - Intronic
990938455 5:61175580-61175602 TGTAGCTTGTAAAACCTGATGGG - Intergenic
992465667 5:77001282-77001304 TGAACCAAGTAAAACGTGGCAGG + Intergenic
1010863392 6:80941585-80941607 TGTAACACTTAACACCTAGTAGG + Intergenic
1011649192 6:89490339-89490361 TGTACTACACAACACCTGGTGGG - Intronic
1018746954 6:166769747-166769769 GGGACCACCTAAAACCAGGTGGG + Intronic
1021232395 7:18101521-18101543 TCTTCCATGTAAAACCTTGTTGG + Intronic
1027882668 7:83861246-83861268 TTTACCATGTAAAACATGATGGG + Intergenic
1028132508 7:87192868-87192890 TGTAGCACGTAAAAACTGGCAGG - Intronic
1030432623 7:109469970-109469992 TGTTCCCAGGAAAACCTGGTAGG - Intergenic
1035403144 7:158581223-158581245 TGTACCACAGGACACCTGGTGGG - Intronic
1052159760 9:25242804-25242826 TGTACCACACAAAAGCTGGGAGG + Intergenic
1052559912 9:30071768-30071790 GGTATCACCTAAAACCTGCTAGG + Intergenic
1188378931 X:29467603-29467625 AGTACCACGTAGTACCTGGAAGG + Intronic
1190051527 X:47153760-47153782 TGTACCTCGAAAAACTTGGTAGG + Intronic
1199702028 X:150387347-150387369 ATTACTACGTAAAAACTGGTTGG - Intronic