ID: 943528093

View in Genome Browser
Species Human (GRCh38)
Location 2:189043239-189043261
Sequence TAGGGACCCCAAGGACCTCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943528093_943528095 -8 Left 943528093 2:189043239-189043261 CCACGAGGTCCTTGGGGTCCCTA 0: 1
1: 0
2: 2
3: 6
4: 100
Right 943528095 2:189043254-189043276 GGTCCCTAGAAATAGAGATATGG 0: 1
1: 0
2: 0
3: 8
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943528093 Original CRISPR TAGGGACCCCAAGGACCTCG TGG (reversed) Exonic
900485514 1:2920889-2920911 TAGGGACCTCAGGGACCTTAGGG - Intergenic
900931201 1:5738995-5739017 GAGTGACTCCAAGGACCTAGAGG - Intergenic
902674007 1:17995789-17995811 AAGGGACACCAAGGAACTCCAGG - Intergenic
904130929 1:28274573-28274595 CAGGGACCCCACTGCCCTCGTGG - Intronic
910522778 1:88141713-88141735 GAGGGACCCCAAAGGCTTCGAGG + Intergenic
911858876 1:102920345-102920367 CAGGGACCACAAGGACCCCCAGG - Exonic
911862774 1:102974864-102974886 CAGGGTCCTCAAGGACCTCAGGG - Exonic
911865523 1:103015723-103015745 TAGGGCCCCCCAGGACGTCCTGG - Exonic
915466556 1:156101835-156101857 TAGGAACCACAAGGACTTGGGGG + Intronic
915593607 1:156884158-156884180 ATGGGGCCCCAAGGACCCCGTGG + Intergenic
1062829754 10:597825-597847 TCAGGACCCCTAGGACCTCATGG - Intronic
1063449326 10:6140831-6140853 TAGGGACCCCAGGGCCCCAGGGG - Intergenic
1070809592 10:79290952-79290974 TAGGGTTCCCAAGGACCTGTGGG - Exonic
1071604951 10:86979582-86979604 GAGGGACCCCCAGGACATTGAGG + Intronic
1073511173 10:104043509-104043531 ATGGGACCCCCAGGACCTCCAGG - Exonic
1076338904 10:129729106-129729128 CAGGGACCCCAAGGAGTTGGAGG + Intronic
1083309052 11:61775265-61775287 CAGGGCCCCCAAGGCCCCCGTGG - Intronic
1084701769 11:70790930-70790952 AGGGGACCCTAAGGTCCTCGAGG + Intronic
1084785185 11:71437984-71438006 TGGGGCCCCCATGGACCTCGGGG + Intronic
1086400480 11:86457373-86457395 CAGGGTCCCCAAGTACCTCCAGG + Intronic
1093533318 12:20193510-20193532 TAGGGACACCAGGGAACTCTGGG - Intergenic
1094347142 12:29483239-29483261 CAGGGACCTCTAGGACCTCTAGG - Intronic
1102518790 12:113466553-113466575 TAGGAACCCCAGGGGTCTCGGGG + Intronic
1110131731 13:72019412-72019434 TAGGGAGCCAAAGGAGCTCAGGG - Intergenic
1111831139 13:93331054-93331076 TAGAGCCCCCAAAGACCTCCTGG - Intronic
1113453425 13:110429882-110429904 TAGGGGCCCCAAGGACCAAAAGG + Exonic
1113730220 13:112636472-112636494 TGGGGACCCCAAGGAATTCAGGG + Intergenic
1114629526 14:24150260-24150282 GAGGGTCCCCAAGGAACTGGAGG + Exonic
1117418370 14:55519122-55519144 TGGGGACCCCAAGGACCCAATGG - Intergenic
1128299626 15:66557812-66557834 TAGTAACCCCAAGGACCTAGAGG - Exonic
1129894459 15:79092976-79092998 TAGGGACCCCAAGGACTCAGTGG + Intergenic
1132309858 15:100849628-100849650 CTGGGACCCCGAGGTCCTCGGGG - Intergenic
1132995518 16:2820494-2820516 TAGGGACCCCCAGCACCCCTGGG - Intronic
1133898379 16:9950357-9950379 TAGGGAGCCCTTGGACCTCATGG + Intronic
1148618080 17:49014785-49014807 TAAGGACCCCGAGGAGCACGGGG + Intronic
1148789907 17:50167275-50167297 TAGGGGCTCCAAGGACTTGGTGG + Intronic
1148793850 17:50187964-50187986 TAGGGACCCCAAGGCCCCCGTGG - Exonic
1150139391 17:62715685-62715707 GTGGGACCCCAGGGACCTGGCGG - Intronic
1152036279 17:77875020-77875042 TAGGTGCCCCAAGGAGCTGGGGG - Intergenic
1153435391 18:5063216-5063238 TAGAGACTACAGGGACCTCGTGG - Intergenic
1157908546 18:51593204-51593226 TGGGGACCCCAGGGGCCTTGAGG + Intergenic
1158632501 18:59128137-59128159 TAAGGAGCCCAAGGGGCTCGAGG + Intergenic
1161068341 19:2248893-2248915 TGGAGACCCCAAGGATATCGTGG - Intergenic
1162744536 19:12791259-12791281 GAGGGGCTCAAAGGACCTCGGGG - Intronic
1163006733 19:14401605-14401627 TAGGGACCCCAGGTACCAGGTGG - Intronic
1165060187 19:33201349-33201371 TAGGGACCACCAGGGCCTCCAGG + Intronic
1166100284 19:40567728-40567750 TGGGGACCCCACGGAACTGGCGG + Exonic
1166682334 19:44776780-44776802 TAGGGAACCCAAGGGCCTGGTGG + Intergenic
1168121529 19:54254741-54254763 TAGTTACCCCCAGGAGCTCGTGG - Exonic
927892893 2:26763607-26763629 CAGGGTCCCCAAGGAACTCCCGG + Intergenic
927938955 2:27091923-27091945 GAGCAACTCCAAGGACCTCGGGG - Intronic
932476747 2:72011233-72011255 TGGGGACCCCAGGGACCCCTGGG - Intergenic
934560896 2:95312810-95312832 GAGGGAGCCCAGGGACCTCACGG + Intronic
934928233 2:98397030-98397052 CGCGGACCCCAAGGACCTTGAGG + Exonic
937060082 2:118974526-118974548 TCGGGACCCCAAGGCCCACCGGG + Exonic
938603509 2:132867722-132867744 TAGGGACCCCAAGGACTTTATGG + Intronic
938697526 2:133848237-133848259 TAGGGCCTGCAAGGACCTGGAGG - Intergenic
940211640 2:151261572-151261594 GAGGGGCCCCAGGGACCCCGGGG - Intronic
941886820 2:170536874-170536896 TAGGGGCCCCAAGAATCTTGAGG - Intronic
943319778 2:186432784-186432806 TAGGGAGCCAAAGGCACTCGGGG - Intergenic
943528093 2:189043239-189043261 TAGGGACCCCAAGGACCTCGTGG - Exonic
948808541 2:240463297-240463319 CAGGCACCCCCAGGGCCTCGGGG + Intronic
1169310246 20:4531955-4531977 TAGGGAACCCCAGGATCTCCAGG + Intergenic
1169635670 20:7689052-7689074 CAGGGAACCCAGGGACCTCAGGG + Intergenic
1173284328 20:41656431-41656453 CAGGGCCCCCAAGGGCCTCTGGG - Intergenic
1175470085 20:59221424-59221446 TAGGGACCCCATCGTCCTCTAGG + Intronic
1176794961 21:13364731-13364753 TAGGGACCAGAAAGACCTCTTGG - Intergenic
1180079905 21:45481960-45481982 CAGGGACCCCCAGGCCCTCCGGG + Exonic
1184745554 22:46453681-46453703 TAGTGACCCAGACGACCTCGGGG - Intronic
1185119614 22:48958111-48958133 TTGGGACCCCACAGAACTCGAGG + Intergenic
954136480 3:48584356-48584378 CAGGGCCCCCCTGGACCTCGTGG - Exonic
961381304 3:126498102-126498124 GGGGGACCCCCAGGACCTGGCGG - Exonic
975122159 4:70740128-70740150 TAGTGACTCAAAGGACCTTGAGG + Intronic
978452649 4:108852261-108852283 TAGGGTCCCCCTGGACCTCCTGG - Exonic
979338808 4:119495246-119495268 CAGTGACCCCAAGGAGCTCACGG - Exonic
986286587 5:6363432-6363454 AAGGCACCCCAAGGAGCTCCAGG - Intergenic
990251578 5:53920963-53920985 AAGTGGCCCCAAGGACCTAGAGG + Intronic
994112239 5:96019660-96019682 TAGGTACCCCCAGGACCTTTGGG - Intergenic
996980595 5:129488862-129488884 TAGGGACCATAAGGACCTTATGG - Intronic
997422126 5:133778094-133778116 CAGTGACCCCAAGGACCTCGAGG - Intergenic
997470729 5:134115447-134115469 CGGGGACGCCAAGGACCGCGGGG + Intronic
998770375 5:145537208-145537230 AAAGGACCCCAAGTACCTTGTGG + Intronic
998878055 5:146620091-146620113 TAGGGACCCAAAGGACCATATGG + Intronic
1000803531 5:165759103-165759125 AAGGAACCCCAAGGATCTCTGGG + Intergenic
1005947263 6:30603512-30603534 AAGGGCCCCCAAGGCCCTGGAGG - Exonic
1006450062 6:34100445-34100467 AAGGGACCCCATGGGCCTCGTGG - Intronic
1010370610 6:75102673-75102695 TAGGGGCCCCCTGGTCCTCGTGG - Exonic
1016670144 6:146695101-146695123 GAGGGACCTCAAGGACTTTGAGG + Intronic
1019681977 7:2355380-2355402 CAGCGACCCCGAGGACTTCGTGG + Exonic
1022465445 7:30650114-30650136 CAGGGACCCTAAGGGCCTCCAGG + Intergenic
1024090935 7:45939290-45939312 TTTGGAACCCAAGAACCTCGCGG + Intergenic
1026891424 7:73985062-73985084 GAGGGACCGCAAGGACCAGGCGG + Intergenic
1027185549 7:75968690-75968712 AAGGGAACCCAAGGAGCTGGAGG - Intronic
1037605863 8:20436662-20436684 TAGGATCCCCAAGGACATGGAGG + Intergenic
1042477361 8:69263690-69263712 TACGGACCCCAAGGGCTGCGAGG + Intergenic
1042858807 8:73294175-73294197 GAGCGACGACAAGGACCTCGCGG - Intronic
1045573277 8:103392003-103392025 TAGGGACCACAGGGACCTGAGGG - Intergenic
1048847362 8:138613874-138613896 CAGGGTCCCCAAGGACCAAGGGG - Exonic
1048868514 8:138778387-138778409 CAGGGGCCCCAAGGACCACCTGG - Exonic
1049112531 8:140656630-140656652 GAGGGAGCCCCAGGACCTCTGGG + Intergenic
1055707042 9:79016989-79017011 TATGGACCCCAAGGGACTAGAGG - Intergenic
1057312625 9:93951681-93951703 TAGGGGCCCCAGCGACATCGGGG + Exonic
1057914850 9:99047783-99047805 TAGGGGCCCAAAGGACCACCAGG + Exonic
1191251986 X:58264137-58264159 TAGGGACCCCATGACCCCCGCGG - Intergenic
1192256605 X:69466194-69466216 GAGGGACTCTAAGGACCTGGAGG - Intergenic
1193016406 X:76738758-76738780 CAGGGACCCCAAGGGCCTGTTGG - Intergenic
1195222849 X:102762952-102762974 GAGGGACCCTAAGGACCTGCCGG + Intergenic
1195798640 X:108681858-108681880 CCAGGACCCCAAGGACCTCAAGG + Exonic
1199863376 X:151821750-151821772 TGGGGACCCCAAGGCCCTGAGGG + Intergenic