ID: 943533617

View in Genome Browser
Species Human (GRCh38)
Location 2:189119176-189119198
Sequence TGCACAGCAAAGCTCTTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943533616_943533617 12 Left 943533616 2:189119141-189119163 CCTTTATTGGAAAGTTATATCAA No data
Right 943533617 2:189119176-189119198 TGCACAGCAAAGCTCTTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943533617 Original CRISPR TGCACAGCAAAGCTCTTCAT TGG Intronic
No off target data available for this crispr