ID: 943536081

View in Genome Browser
Species Human (GRCh38)
Location 2:189152515-189152537
Sequence ATTCACAGTGGAACACAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943536077_943536081 -10 Left 943536077 2:189152502-189152524 CCTTTCCCAGAGAATTCACAGTG No data
Right 943536081 2:189152515-189152537 ATTCACAGTGGAACACAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943536081 Original CRISPR ATTCACAGTGGAACACAGTC AGG Intronic
No off target data available for this crispr