ID: 943539086

View in Genome Browser
Species Human (GRCh38)
Location 2:189189234-189189256
Sequence CTCTATCAGGAGAAGAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943539086_943539090 -3 Left 943539086 2:189189234-189189256 CCTCTCTTCTTCTCCTGATAGAG No data
Right 943539090 2:189189254-189189276 GAGATGTATCAAATGGGAGACGG No data
943539086_943539088 -10 Left 943539086 2:189189234-189189256 CCTCTCTTCTTCTCCTGATAGAG No data
Right 943539088 2:189189247-189189269 CCTGATAGAGATGTATCAAATGG No data
943539086_943539089 -9 Left 943539086 2:189189234-189189256 CCTCTCTTCTTCTCCTGATAGAG No data
Right 943539089 2:189189248-189189270 CTGATAGAGATGTATCAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943539086 Original CRISPR CTCTATCAGGAGAAGAAGAG AGG (reversed) Intergenic
No off target data available for this crispr