ID: 943544698

View in Genome Browser
Species Human (GRCh38)
Location 2:189260309-189260331
Sequence TTTGCAGGCACTGTACTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943544698_943544705 29 Left 943544698 2:189260309-189260331 CCTAGGAGTACAGTGCCTGCAAA No data
Right 943544705 2:189260361-189260383 TTGGGTAGCCCAGTGACTGCAGG No data
943544698_943544704 11 Left 943544698 2:189260309-189260331 CCTAGGAGTACAGTGCCTGCAAA No data
Right 943544704 2:189260343-189260365 GTTGGCAACTAAGAGTATTTGGG No data
943544698_943544703 10 Left 943544698 2:189260309-189260331 CCTAGGAGTACAGTGCCTGCAAA No data
Right 943544703 2:189260342-189260364 AGTTGGCAACTAAGAGTATTTGG No data
943544698_943544701 -7 Left 943544698 2:189260309-189260331 CCTAGGAGTACAGTGCCTGCAAA No data
Right 943544701 2:189260325-189260347 CTGCAAATGCCAAGGCTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943544698 Original CRISPR TTTGCAGGCACTGTACTCCT AGG (reversed) Intergenic
No off target data available for this crispr