ID: 943544700

View in Genome Browser
Species Human (GRCh38)
Location 2:189260324-189260346
Sequence CAACTAGCCTTGGCATTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943544700_943544704 -4 Left 943544700 2:189260324-189260346 CCTGCAAATGCCAAGGCTAGTTG No data
Right 943544704 2:189260343-189260365 GTTGGCAACTAAGAGTATTTGGG No data
943544700_943544703 -5 Left 943544700 2:189260324-189260346 CCTGCAAATGCCAAGGCTAGTTG No data
Right 943544703 2:189260342-189260364 AGTTGGCAACTAAGAGTATTTGG No data
943544700_943544705 14 Left 943544700 2:189260324-189260346 CCTGCAAATGCCAAGGCTAGTTG No data
Right 943544705 2:189260361-189260383 TTGGGTAGCCCAGTGACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943544700 Original CRISPR CAACTAGCCTTGGCATTTGC AGG (reversed) Intergenic
No off target data available for this crispr