ID: 943544701

View in Genome Browser
Species Human (GRCh38)
Location 2:189260325-189260347
Sequence CTGCAAATGCCAAGGCTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943544696_943544701 29 Left 943544696 2:189260273-189260295 CCTTTAGCAAACAGAGATAATGT No data
Right 943544701 2:189260325-189260347 CTGCAAATGCCAAGGCTAGTTGG No data
943544698_943544701 -7 Left 943544698 2:189260309-189260331 CCTAGGAGTACAGTGCCTGCAAA No data
Right 943544701 2:189260325-189260347 CTGCAAATGCCAAGGCTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943544701 Original CRISPR CTGCAAATGCCAAGGCTAGT TGG Intergenic
No off target data available for this crispr