ID: 943544702

View in Genome Browser
Species Human (GRCh38)
Location 2:189260334-189260356
Sequence TCTTAGTTGCCAACTAGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943544702_943544708 23 Left 943544702 2:189260334-189260356 CCAAGGCTAGTTGGCAACTAAGA No data
Right 943544708 2:189260380-189260402 CAGGAGACTCATTCTAGAACTGG No data
943544702_943544710 27 Left 943544702 2:189260334-189260356 CCAAGGCTAGTTGGCAACTAAGA No data
Right 943544710 2:189260384-189260406 AGACTCATTCTAGAACTGGGAGG No data
943544702_943544709 24 Left 943544702 2:189260334-189260356 CCAAGGCTAGTTGGCAACTAAGA No data
Right 943544709 2:189260381-189260403 AGGAGACTCATTCTAGAACTGGG No data
943544702_943544705 4 Left 943544702 2:189260334-189260356 CCAAGGCTAGTTGGCAACTAAGA No data
Right 943544705 2:189260361-189260383 TTGGGTAGCCCAGTGACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943544702 Original CRISPR TCTTAGTTGCCAACTAGCCT TGG (reversed) Intergenic
No off target data available for this crispr