ID: 943544703

View in Genome Browser
Species Human (GRCh38)
Location 2:189260342-189260364
Sequence AGTTGGCAACTAAGAGTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943544700_943544703 -5 Left 943544700 2:189260324-189260346 CCTGCAAATGCCAAGGCTAGTTG No data
Right 943544703 2:189260342-189260364 AGTTGGCAACTAAGAGTATTTGG No data
943544698_943544703 10 Left 943544698 2:189260309-189260331 CCTAGGAGTACAGTGCCTGCAAA No data
Right 943544703 2:189260342-189260364 AGTTGGCAACTAAGAGTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943544703 Original CRISPR AGTTGGCAACTAAGAGTATT TGG Intergenic
No off target data available for this crispr