ID: 943544704

View in Genome Browser
Species Human (GRCh38)
Location 2:189260343-189260365
Sequence GTTGGCAACTAAGAGTATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943544698_943544704 11 Left 943544698 2:189260309-189260331 CCTAGGAGTACAGTGCCTGCAAA No data
Right 943544704 2:189260343-189260365 GTTGGCAACTAAGAGTATTTGGG No data
943544700_943544704 -4 Left 943544700 2:189260324-189260346 CCTGCAAATGCCAAGGCTAGTTG No data
Right 943544704 2:189260343-189260365 GTTGGCAACTAAGAGTATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943544704 Original CRISPR GTTGGCAACTAAGAGTATTT GGG Intergenic
No off target data available for this crispr