ID: 943544705

View in Genome Browser
Species Human (GRCh38)
Location 2:189260361-189260383
Sequence TTGGGTAGCCCAGTGACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943544700_943544705 14 Left 943544700 2:189260324-189260346 CCTGCAAATGCCAAGGCTAGTTG No data
Right 943544705 2:189260361-189260383 TTGGGTAGCCCAGTGACTGCAGG No data
943544702_943544705 4 Left 943544702 2:189260334-189260356 CCAAGGCTAGTTGGCAACTAAGA No data
Right 943544705 2:189260361-189260383 TTGGGTAGCCCAGTGACTGCAGG No data
943544698_943544705 29 Left 943544698 2:189260309-189260331 CCTAGGAGTACAGTGCCTGCAAA No data
Right 943544705 2:189260361-189260383 TTGGGTAGCCCAGTGACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943544705 Original CRISPR TTGGGTAGCCCAGTGACTGC AGG Intergenic
No off target data available for this crispr