ID: 943549105

View in Genome Browser
Species Human (GRCh38)
Location 2:189316589-189316611
Sequence GAGGGTAAAGAGTGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5588
Summary {0: 6, 1: 46, 2: 436, 3: 1553, 4: 3547}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943549105 Original CRISPR GAGGGTAAAGAGTGGGAGGA GGG Intergenic
Too many off-targets to display for this crispr