ID: 943557329

View in Genome Browser
Species Human (GRCh38)
Location 2:189421641-189421663
Sequence GAGGCTAGGTCTGTGGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943557329_943557333 -9 Left 943557329 2:189421641-189421663 CCAGTGCCCACAGACCTAGCCTC No data
Right 943557333 2:189421655-189421677 CCTAGCCTCAATGACTGCCCAGG No data
943557329_943557334 -8 Left 943557329 2:189421641-189421663 CCAGTGCCCACAGACCTAGCCTC No data
Right 943557334 2:189421656-189421678 CTAGCCTCAATGACTGCCCAGGG No data
943557329_943557336 1 Left 943557329 2:189421641-189421663 CCAGTGCCCACAGACCTAGCCTC No data
Right 943557336 2:189421665-189421687 ATGACTGCCCAGGGACCAAGTGG No data
943557329_943557337 2 Left 943557329 2:189421641-189421663 CCAGTGCCCACAGACCTAGCCTC No data
Right 943557337 2:189421666-189421688 TGACTGCCCAGGGACCAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943557329 Original CRISPR GAGGCTAGGTCTGTGGGCAC TGG (reversed) Intergenic
No off target data available for this crispr