ID: 943564605

View in Genome Browser
Species Human (GRCh38)
Location 2:189503074-189503096
Sequence CAGGTCTCCCTGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943564605_943564615 7 Left 943564605 2:189503074-189503096 CCCTCTTCCTTCAGGGAGACCTG No data
Right 943564615 2:189503104-189503126 CTGGCACTACCAGACTCCTCAGG No data
943564605_943564618 25 Left 943564605 2:189503074-189503096 CCCTCTTCCTTCAGGGAGACCTG No data
Right 943564618 2:189503122-189503144 TCAGGCCCATCATCTGCTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943564605 Original CRISPR CAGGTCTCCCTGAAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr