ID: 943564871

View in Genome Browser
Species Human (GRCh38)
Location 2:189505545-189505567
Sequence CTGGAAGGTGAATGTGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943564863_943564871 23 Left 943564863 2:189505499-189505521 CCAGGCAGGGGGAAATGCCTTCT No data
Right 943564871 2:189505545-189505567 CTGGAAGGTGAATGTGTTGTTGG No data
943564865_943564871 6 Left 943564865 2:189505516-189505538 CCTTCTAAAAGGCCTTGAGACAA No data
Right 943564871 2:189505545-189505567 CTGGAAGGTGAATGTGTTGTTGG No data
943564868_943564871 -6 Left 943564868 2:189505528-189505550 CCTTGAGACAAAAGGACCTGGAA No data
Right 943564871 2:189505545-189505567 CTGGAAGGTGAATGTGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943564871 Original CRISPR CTGGAAGGTGAATGTGTTGT TGG Intergenic
No off target data available for this crispr