ID: 943569971

View in Genome Browser
Species Human (GRCh38)
Location 2:189562587-189562609
Sequence CTCTAGCAGTAATATAACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943569971_943569974 12 Left 943569971 2:189562587-189562609 CCATTGTTATATTACTGCTAGAG No data
Right 943569974 2:189562622-189562644 AACAATAAAGCTGTCTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943569971 Original CRISPR CTCTAGCAGTAATATAACAA TGG (reversed) Intronic
No off target data available for this crispr