ID: 943577136

View in Genome Browser
Species Human (GRCh38)
Location 2:189643072-189643094
Sequence AAAAAAAAGGAGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943577136_943577142 24 Left 943577136 2:189643072-189643094 CCTCCCTCCTTCTCCTTTTTTTT No data
Right 943577142 2:189643119-189643141 TTCTGCTTCTAAGCTTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943577136 Original CRISPR AAAAAAAAGGAGAAGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr