ID: 943583148

View in Genome Browser
Species Human (GRCh38)
Location 2:189708019-189708041
Sequence CTTCAGAAATAGAAAGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943583144_943583148 -6 Left 943583144 2:189708002-189708024 CCAAGGCTAGAATTCTCCTTCAG No data
Right 943583148 2:189708019-189708041 CTTCAGAAATAGAAAGGAGAGGG No data
943583143_943583148 4 Left 943583143 2:189707992-189708014 CCTAAAGATGCCAAGGCTAGAAT No data
Right 943583148 2:189708019-189708041 CTTCAGAAATAGAAAGGAGAGGG No data
943583140_943583148 27 Left 943583140 2:189707969-189707991 CCTCAAAGCCTAACTAGGAAAGA No data
Right 943583148 2:189708019-189708041 CTTCAGAAATAGAAAGGAGAGGG No data
943583141_943583148 19 Left 943583141 2:189707977-189707999 CCTAACTAGGAAAGACCTAAAGA No data
Right 943583148 2:189708019-189708041 CTTCAGAAATAGAAAGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943583148 Original CRISPR CTTCAGAAATAGAAAGGAGA GGG Intronic
No off target data available for this crispr