ID: 943584777 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:189725535-189725557 |
| Sequence | AGGCATATCTATAGGACACA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 943584774_943584777 | 2 | Left | 943584774 | 2:189725510-189725532 | CCTTTTTTTTACTATCTATATCT | No data | ||
| Right | 943584777 | 2:189725535-189725557 | AGGCATATCTATAGGACACAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 943584777 | Original CRISPR | AGGCATATCTATAGGACACA AGG | Intronic | ||
| No off target data available for this crispr | |||||