ID: 943584777

View in Genome Browser
Species Human (GRCh38)
Location 2:189725535-189725557
Sequence AGGCATATCTATAGGACACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943584774_943584777 2 Left 943584774 2:189725510-189725532 CCTTTTTTTTACTATCTATATCT No data
Right 943584777 2:189725535-189725557 AGGCATATCTATAGGACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943584777 Original CRISPR AGGCATATCTATAGGACACA AGG Intronic
No off target data available for this crispr