ID: 943589782

View in Genome Browser
Species Human (GRCh38)
Location 2:189783903-189783925
Sequence CTCGCCGGTGCCTCCGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943589776_943589782 11 Left 943589776 2:189783869-189783891 CCTTACAGACCGTGAAGAGGCTG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 943589782 2:189783903-189783925 CTCGCCGGTGCCTCCGAAGACGG 0: 1
1: 0
2: 0
3: 1
4: 31
943589778_943589782 2 Left 943589778 2:189783878-189783900 CCGTGAAGAGGCTGTTGGCTCTG 0: 1
1: 0
2: 2
3: 34
4: 244
Right 943589782 2:189783903-189783925 CTCGCCGGTGCCTCCGAAGACGG 0: 1
1: 0
2: 0
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943589782 Original CRISPR CTCGCCGGTGCCTCCGAAGA CGG Intronic
1069889748 10:71645497-71645519 CTGGCCGGTCCCTCCGCAGCTGG + Intronic
1073351453 10:102822880-102822902 CTCACCAGAGCCTCGGAAGATGG + Intergenic
1074165676 10:110872075-110872097 CTTGCGGCTGCCTCCGAGGAGGG - Intronic
1086724634 11:90167271-90167293 CTGGCCGGCGCCTCCGAGGGCGG - Intronic
1105503126 13:20989246-20989268 ATCGCCGGTTCCTTCGAAGCTGG + Exonic
1114554185 14:23551927-23551949 CAAGCCGGTGCCTGCAAAGAGGG + Intronic
1125769619 15:42156438-42156460 CCCGCCAGTGCCTCCACAGAGGG + Exonic
1129336223 15:74853754-74853776 CTCCTCGGTGCCTCCAGAGAGGG - Intronic
1140927662 16:79599438-79599460 CTCGCCGCTGCCGCCCAAGGAGG + Exonic
1141210394 16:81973936-81973958 CTCGCCGTTGCCTCAGGAAATGG - Intergenic
1142476596 17:192831-192853 CTGGCAGGTGCCACCGAGGATGG - Intergenic
1150147464 17:62780989-62781011 CTCGCCGGTGCCTGGGAAGGAGG + Intronic
1168346223 19:55651384-55651406 CTCAGCGGAGCGTCCGAAGAAGG + Exonic
925376243 2:3388171-3388193 CTCGCTGGCGCCACCGAAGCTGG - Exonic
934777787 2:96950065-96950087 CTCGTCTGTGCCTCCCAGGATGG + Intronic
943589782 2:189783903-189783925 CTCGCCGGTGCCTCCGAAGACGG + Intronic
945671820 2:212811232-212811254 CTGGCCCTTGCCTCAGAAGAAGG + Intergenic
1174330440 20:49813075-49813097 CAAGCCGGTGCCTACGAGGAGGG + Intronic
1175044270 20:56089692-56089714 CTCGCTGGCTCCTCTGAAGAGGG + Intergenic
1178461001 21:32802385-32802407 CTTGCAGGAGCCTCCAAAGAGGG - Intronic
1180628887 22:17213483-17213505 CTCCCCGGTGCTTCGGTAGATGG - Intronic
1184003009 22:41688949-41688971 CGCGCCAGTGCCCCCGTAGAGGG - Intronic
983372287 4:166876082-166876104 CTCGCTGTTGCCTTGGAAGAAGG + Intronic
1036751103 8:11444203-11444225 CTCGCCTGTGGCTCCGCAGCCGG + Exonic
1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG + Exonic
1049164231 8:141116646-141116668 CTCGCAGGTGCGGCCCAAGAGGG + Intergenic
1059419349 9:114181353-114181375 CTTGCCGGTGCATTCGGAGAAGG + Intronic
1060283510 9:122228928-122228950 GCCGCCGCTGCCTCGGAAGAAGG + Intronic
1062409210 9:136413852-136413874 GTCACCAGTGCCTCTGAAGAGGG - Intronic
1203759387 EBV:4183-4205 CACGCCAGTGCTTCAGAAGACGG + Intergenic
1192634503 X:72804863-72804885 GTCGACAGTGCCTCAGAAGAAGG - Intronic
1192647209 X:72915938-72915960 GTCGACAGTGCCTCAGAAGAAGG + Intronic
1198530738 X:137548285-137548307 CTCGCCGGTATCTCCGGGGAAGG - Intergenic