ID: 943589800

View in Genome Browser
Species Human (GRCh38)
Location 2:189783964-189783986
Sequence GACCGACAGCCCGAGCGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 41}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943589792_943589800 2 Left 943589792 2:189783939-189783961 CCCCTCAGGGGAGTCCCCCCTGC 0: 1
1: 0
2: 1
3: 39
4: 160
Right 943589800 2:189783964-189783986 GACCGACAGCCCGAGCGCTCTGG 0: 1
1: 0
2: 0
3: 1
4: 41
943589794_943589800 0 Left 943589794 2:189783941-189783963 CCTCAGGGGAGTCCCCCCTGCTA 0: 1
1: 0
2: 1
3: 5
4: 133
Right 943589800 2:189783964-189783986 GACCGACAGCCCGAGCGCTCTGG 0: 1
1: 0
2: 0
3: 1
4: 41
943589785_943589800 25 Left 943589785 2:189783916-189783938 CCGAAGACGGCGACCCGCAGCGG 0: 1
1: 0
2: 1
3: 0
4: 42
Right 943589800 2:189783964-189783986 GACCGACAGCCCGAGCGCTCTGG 0: 1
1: 0
2: 0
3: 1
4: 41
943589790_943589800 12 Left 943589790 2:189783929-189783951 CCCGCAGCGGCCCCTCAGGGGAG 0: 1
1: 0
2: 2
3: 30
4: 269
Right 943589800 2:189783964-189783986 GACCGACAGCCCGAGCGCTCTGG 0: 1
1: 0
2: 0
3: 1
4: 41
943589793_943589800 1 Left 943589793 2:189783940-189783962 CCCTCAGGGGAGTCCCCCCTGCT 0: 1
1: 0
2: 1
3: 10
4: 177
Right 943589800 2:189783964-189783986 GACCGACAGCCCGAGCGCTCTGG 0: 1
1: 0
2: 0
3: 1
4: 41
943589784_943589800 28 Left 943589784 2:189783913-189783935 CCTCCGAAGACGGCGACCCGCAG 0: 1
1: 0
2: 0
3: 4
4: 25
Right 943589800 2:189783964-189783986 GACCGACAGCCCGAGCGCTCTGG 0: 1
1: 0
2: 0
3: 1
4: 41
943589791_943589800 11 Left 943589791 2:189783930-189783952 CCGCAGCGGCCCCTCAGGGGAGT 0: 1
1: 0
2: 0
3: 6
4: 187
Right 943589800 2:189783964-189783986 GACCGACAGCCCGAGCGCTCTGG 0: 1
1: 0
2: 0
3: 1
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943589800 Original CRISPR GACCGACAGCCCGAGCGCTC TGG Intronic
901055979 1:6448809-6448831 GCCCGCCAGCCCGCGCGCGCCGG + Exonic
1063415434 10:5869380-5869402 GACCTACAGGCCCAGCTCTCTGG + Intronic
1073062529 10:100741167-100741189 GACCAACAGACCGAGCGGGCGGG + Intronic
1084121313 11:67070640-67070662 GACCTACACCCTGAGCGTTCTGG - Intronic
1089976011 11:122732091-122732113 GACAGACAGCCCTAGCCCTGAGG + Intronic
1091225902 11:133956450-133956472 GCCCGGCAGCCCGTGGGCTCTGG + Intronic
1091328695 11:134713341-134713363 GTCCGACAGCAGAAGCGCTCCGG - Intergenic
1113642047 13:111964658-111964680 CACCCACAGCCGGACCGCTCTGG + Intergenic
1114553999 14:23551145-23551167 GACAGACAGACCGAGAGCCCTGG - Intronic
1121828823 14:97032995-97033017 GAGCCACAGCGCGCGCGCTCTGG - Intergenic
1132275365 15:100558989-100559011 GCCCGGCTACCCGAGCGCTCCGG - Intergenic
1133022233 16:2971790-2971812 GCCCGTCTGCCCGAGCGCTGGGG + Exonic
1136129704 16:28211939-28211961 GACCAACAGCCCCAACGCGCCGG + Intergenic
1138119012 16:54383227-54383249 AACCTACAGCCCGGGAGCTCTGG - Intergenic
1144890165 17:18489825-18489847 GACCCACAGTCCCAGCCCTCTGG - Intronic
1145142051 17:20454492-20454514 GACCCACAGTCCCAGCCCTCTGG + Intronic
1163314590 19:16533190-16533212 GACCCGCAGCCTGAGCCCTCCGG + Intronic
1163602011 19:18255006-18255028 GACCCACAGCCCCAGGGCTTGGG + Intronic
925070142 2:960328-960350 AACAGGCAGCCCGAGCTCTCGGG - Intronic
927138410 2:20113793-20113815 CACAGACAGCCCCAGGGCTCAGG + Intergenic
932445699 2:71779696-71779718 AACCCACAGCCCCAGCCCTCTGG - Intergenic
943589800 2:189783964-189783986 GACCGACAGCCCGAGCGCTCTGG + Intronic
946307861 2:218866166-218866188 CACCCACAGCCCCAGGGCTCAGG + Intronic
948485288 2:238276923-238276945 GAGCGACATCCCGGGGGCTCTGG + Intronic
949004226 2:241636593-241636615 GGCCGACGGCCCGCGCGGTCCGG + Intronic
949027355 2:241772813-241772835 GACCTAAACCCCGAGCGCTCAGG - Intergenic
1169200388 20:3706424-3706446 GACCTGCAGCCCGAGGACTCTGG - Exonic
1182415157 22:30216728-30216750 GACAGACACTCCGAGCGCCCAGG - Intergenic
1182501325 22:30750035-30750057 GACCGTCAGGCCCAGCCCTCTGG - Intronic
1185333379 22:50261403-50261425 GACCTGCAGCCCGTGGGCTCGGG - Exonic
955224915 3:57052722-57052744 GATCTACAGCCAGAGCACTCGGG + Intronic
1002790191 6:431842-431864 GCCCGCCAGCACGAGGGCTCCGG + Intergenic
1004177386 6:13351497-13351519 CACCGACAGCCCCAGTACTCTGG - Intergenic
1014230192 6:118894535-118894557 AACTGACAGCCCGGGCGCACGGG - Intronic
1019593666 7:1848344-1848366 GACGGACAGCCCGGGGTCTCAGG + Exonic
1022113049 7:27243171-27243193 GAGGGACGGCCCGAGGGCTCAGG - Exonic
1034499363 7:151440012-151440034 GCCCGACAGCACTAACGCTCCGG - Exonic
1061119462 9:128634352-128634374 GCCCGTCAGTCCCAGCGCTCAGG + Exonic
1185877619 X:3713288-3713310 GCCCGGCTCCCCGAGCGCTCCGG - Exonic
1185894171 X:3843517-3843539 GCCCGGCTCCCCGAGCGCTCCGG - Exonic
1185899290 X:3881941-3881963 GCCCGGCTCCCCGAGCGCTCCGG - Intergenic
1185904407 X:3920370-3920392 GCCCGGCTCCCCGAGCGCTCCGG - Intergenic
1200787689 Y:7274256-7274278 GTCCGGCTTCCCGAGCGCTCCGG + Intergenic