ID: 943600202

View in Genome Browser
Species Human (GRCh38)
Location 2:189908529-189908551
Sequence GCATCGAATAAGTTTTGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943600200_943600202 11 Left 943600200 2:189908495-189908517 CCCTATATACTTACTTCTTAAGA No data
Right 943600202 2:189908529-189908551 GCATCGAATAAGTTTTGACATGG No data
943600197_943600202 24 Left 943600197 2:189908482-189908504 CCACTGTGCCCAGCCCTATATAC No data
Right 943600202 2:189908529-189908551 GCATCGAATAAGTTTTGACATGG No data
943600199_943600202 15 Left 943600199 2:189908491-189908513 CCAGCCCTATATACTTACTTCTT No data
Right 943600202 2:189908529-189908551 GCATCGAATAAGTTTTGACATGG No data
943600198_943600202 16 Left 943600198 2:189908490-189908512 CCCAGCCCTATATACTTACTTCT No data
Right 943600202 2:189908529-189908551 GCATCGAATAAGTTTTGACATGG No data
943600201_943600202 10 Left 943600201 2:189908496-189908518 CCTATATACTTACTTCTTAAGAC No data
Right 943600202 2:189908529-189908551 GCATCGAATAAGTTTTGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943600202 Original CRISPR GCATCGAATAAGTTTTGACA TGG Intronic
No off target data available for this crispr