ID: 943600793

View in Genome Browser
Species Human (GRCh38)
Location 2:189918931-189918953
Sequence CTGTGGATAAGGGGGGACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943600793_943600799 -8 Left 943600793 2:189918931-189918953 CCATAGTCCCCCCTTATCCACAG No data
Right 943600799 2:189918946-189918968 ATCCACAGTTTTACTTTCCATGG 0: 3
1: 18
2: 61
3: 177
4: 433
943600793_943600802 18 Left 943600793 2:189918931-189918953 CCATAGTCCCCCCTTATCCACAG No data
Right 943600802 2:189918972-189918994 TAGTTACCTCTAGTTAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943600793 Original CRISPR CTGTGGATAAGGGGGGACTA TGG (reversed) Intronic
No off target data available for this crispr