ID: 943601122

View in Genome Browser
Species Human (GRCh38)
Location 2:189922436-189922458
Sequence ACATGGGTATAGAGAGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943601118_943601122 6 Left 943601118 2:189922407-189922429 CCATAACCAATATGAGTTGTCTA No data
Right 943601122 2:189922436-189922458 ACATGGGTATAGAGAGAAGTAGG No data
943601119_943601122 0 Left 943601119 2:189922413-189922435 CCAATATGAGTTGTCTAAACTAG No data
Right 943601122 2:189922436-189922458 ACATGGGTATAGAGAGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943601122 Original CRISPR ACATGGGTATAGAGAGAAGT AGG Intronic
No off target data available for this crispr