ID: 943603683

View in Genome Browser
Species Human (GRCh38)
Location 2:189950995-189951017
Sequence CAGAATATGGGGAATTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943603679_943603683 4 Left 943603679 2:189950968-189950990 CCTGGAGGGTTGGGGTGGGGGTA No data
Right 943603683 2:189950995-189951017 CAGAATATGGGGAATTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943603683 Original CRISPR CAGAATATGGGGAATTTTTC TGG Intronic
No off target data available for this crispr