ID: 943605522

View in Genome Browser
Species Human (GRCh38)
Location 2:189972844-189972866
Sequence GCTGATAAGCAACTTTAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943605522_943605526 -7 Left 943605522 2:189972844-189972866 CCTTGCTAAAGTTGCTTATCAGC No data
Right 943605526 2:189972860-189972882 TATCAGCTTAAGGAGATTTGGGG 0: 754
1: 10452
2: 4404
3: 2245
4: 1642
943605522_943605525 -8 Left 943605522 2:189972844-189972866 CCTTGCTAAAGTTGCTTATCAGC No data
Right 943605525 2:189972859-189972881 TTATCAGCTTAAGGAGATTTGGG 0: 9766
1: 5142
2: 2748
3: 1620
4: 1461
943605522_943605528 6 Left 943605522 2:189972844-189972866 CCTTGCTAAAGTTGCTTATCAGC No data
Right 943605528 2:189972873-189972895 AGATTTGGGGCTGAGATGATGGG 0: 200
1: 2240
2: 4928
3: 7094
4: 3209
943605522_943605527 5 Left 943605522 2:189972844-189972866 CCTTGCTAAAGTTGCTTATCAGC No data
Right 943605527 2:189972872-189972894 GAGATTTGGGGCTGAGATGATGG 0: 209
1: 2208
2: 4843
3: 7138
4: 3273
943605522_943605524 -9 Left 943605522 2:189972844-189972866 CCTTGCTAAAGTTGCTTATCAGC No data
Right 943605524 2:189972858-189972880 CTTATCAGCTTAAGGAGATTTGG 0: 712
1: 622
2: 483
3: 370
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943605522 Original CRISPR GCTGATAAGCAACTTTAGCA AGG (reversed) Intronic
No off target data available for this crispr