ID: 943605524

View in Genome Browser
Species Human (GRCh38)
Location 2:189972858-189972880
Sequence CTTATCAGCTTAAGGAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2579
Summary {0: 712, 1: 622, 2: 483, 3: 370, 4: 392}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943605521_943605524 -2 Left 943605521 2:189972837-189972859 CCTGAGACCTTGCTAAAGTTGCT No data
Right 943605524 2:189972858-189972880 CTTATCAGCTTAAGGAGATTTGG 0: 712
1: 622
2: 483
3: 370
4: 392
943605522_943605524 -9 Left 943605522 2:189972844-189972866 CCTTGCTAAAGTTGCTTATCAGC No data
Right 943605524 2:189972858-189972880 CTTATCAGCTTAAGGAGATTTGG 0: 712
1: 622
2: 483
3: 370
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943605524 Original CRISPR CTTATCAGCTTAAGGAGATT TGG Intronic
Too many off-targets to display for this crispr