ID: 943605525

View in Genome Browser
Species Human (GRCh38)
Location 2:189972859-189972881
Sequence TTATCAGCTTAAGGAGATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20737
Summary {0: 9766, 1: 5142, 2: 2748, 3: 1620, 4: 1461}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943605521_943605525 -1 Left 943605521 2:189972837-189972859 CCTGAGACCTTGCTAAAGTTGCT No data
Right 943605525 2:189972859-189972881 TTATCAGCTTAAGGAGATTTGGG 0: 9766
1: 5142
2: 2748
3: 1620
4: 1461
943605522_943605525 -8 Left 943605522 2:189972844-189972866 CCTTGCTAAAGTTGCTTATCAGC No data
Right 943605525 2:189972859-189972881 TTATCAGCTTAAGGAGATTTGGG 0: 9766
1: 5142
2: 2748
3: 1620
4: 1461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943605525 Original CRISPR TTATCAGCTTAAGGAGATTT GGG Intronic
Too many off-targets to display for this crispr