ID: 943605526

View in Genome Browser
Species Human (GRCh38)
Location 2:189972860-189972882
Sequence TATCAGCTTAAGGAGATTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19497
Summary {0: 754, 1: 10452, 2: 4404, 3: 2245, 4: 1642}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943605522_943605526 -7 Left 943605522 2:189972844-189972866 CCTTGCTAAAGTTGCTTATCAGC No data
Right 943605526 2:189972860-189972882 TATCAGCTTAAGGAGATTTGGGG 0: 754
1: 10452
2: 4404
3: 2245
4: 1642
943605521_943605526 0 Left 943605521 2:189972837-189972859 CCTGAGACCTTGCTAAAGTTGCT No data
Right 943605526 2:189972860-189972882 TATCAGCTTAAGGAGATTTGGGG 0: 754
1: 10452
2: 4404
3: 2245
4: 1642

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943605526 Original CRISPR TATCAGCTTAAGGAGATTTG GGG Intronic
Too many off-targets to display for this crispr