ID: 943605527

View in Genome Browser
Species Human (GRCh38)
Location 2:189972872-189972894
Sequence GAGATTTGGGGCTGAGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17671
Summary {0: 209, 1: 2208, 2: 4843, 3: 7138, 4: 3273}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943605521_943605527 12 Left 943605521 2:189972837-189972859 CCTGAGACCTTGCTAAAGTTGCT No data
Right 943605527 2:189972872-189972894 GAGATTTGGGGCTGAGATGATGG 0: 209
1: 2208
2: 4843
3: 7138
4: 3273
943605522_943605527 5 Left 943605522 2:189972844-189972866 CCTTGCTAAAGTTGCTTATCAGC No data
Right 943605527 2:189972872-189972894 GAGATTTGGGGCTGAGATGATGG 0: 209
1: 2208
2: 4843
3: 7138
4: 3273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943605527 Original CRISPR GAGATTTGGGGCTGAGATGA TGG Intronic
Too many off-targets to display for this crispr