ID: 943605528

View in Genome Browser
Species Human (GRCh38)
Location 2:189972873-189972895
Sequence AGATTTGGGGCTGAGATGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17671
Summary {0: 200, 1: 2240, 2: 4928, 3: 7094, 4: 3209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943605522_943605528 6 Left 943605522 2:189972844-189972866 CCTTGCTAAAGTTGCTTATCAGC No data
Right 943605528 2:189972873-189972895 AGATTTGGGGCTGAGATGATGGG 0: 200
1: 2240
2: 4928
3: 7094
4: 3209
943605521_943605528 13 Left 943605521 2:189972837-189972859 CCTGAGACCTTGCTAAAGTTGCT No data
Right 943605528 2:189972873-189972895 AGATTTGGGGCTGAGATGATGGG 0: 200
1: 2240
2: 4928
3: 7094
4: 3209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943605528 Original CRISPR AGATTTGGGGCTGAGATGAT GGG Intronic
Too many off-targets to display for this crispr