ID: 943608512 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:190004839-190004861 |
Sequence | AAGGTTATGAACACTGTTGT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
943608509_943608512 | 5 | Left | 943608509 | 2:190004811-190004833 | CCATTTTAATTGGATGTTCAGTA | No data | ||
Right | 943608512 | 2:190004839-190004861 | AAGGTTATGAACACTGTTGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
943608512 | Original CRISPR | AAGGTTATGAACACTGTTGT AGG | Intronic | ||
No off target data available for this crispr |