ID: 943608512

View in Genome Browser
Species Human (GRCh38)
Location 2:190004839-190004861
Sequence AAGGTTATGAACACTGTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943608509_943608512 5 Left 943608509 2:190004811-190004833 CCATTTTAATTGGATGTTCAGTA No data
Right 943608512 2:190004839-190004861 AAGGTTATGAACACTGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943608512 Original CRISPR AAGGTTATGAACACTGTTGT AGG Intronic
No off target data available for this crispr