ID: 943616568

View in Genome Browser
Species Human (GRCh38)
Location 2:190099451-190099473
Sequence TCTTATATGGACACGGTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943616565_943616568 26 Left 943616565 2:190099402-190099424 CCAGTTTGTGGAGCAGTCAGGAC No data
Right 943616568 2:190099451-190099473 TCTTATATGGACACGGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943616568 Original CRISPR TCTTATATGGACACGGTTCA AGG Intronic
No off target data available for this crispr