ID: 943617202

View in Genome Browser
Species Human (GRCh38)
Location 2:190106896-190106918
Sequence TTTAAGCTGTTCCTCAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943617202_943617203 -9 Left 943617202 2:190106896-190106918 CCATCACTGAGGAACAGCTTAAA No data
Right 943617203 2:190106910-190106932 CAGCTTAAATTCACCAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943617202 Original CRISPR TTTAAGCTGTTCCTCAGTGA TGG (reversed) Intronic
No off target data available for this crispr