ID: 943631161

View in Genome Browser
Species Human (GRCh38)
Location 2:190253957-190253979
Sequence CTGGAAAGAAGCAGAATTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943631161_943631171 23 Left 943631161 2:190253957-190253979 CCCCCAATTCTGCTTCTTTCCAG No data
Right 943631171 2:190254003-190254025 TCTGCTTGACCTCTTGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943631161 Original CRISPR CTGGAAAGAAGCAGAATTGG GGG (reversed) Intronic
No off target data available for this crispr