ID: 943637235

View in Genome Browser
Species Human (GRCh38)
Location 2:190319646-190319668
Sequence GCCACAGTGGGAAAAGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 375}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943637235_943637241 4 Left 943637235 2:190319646-190319668 CCCGGCCCTTTTCCCACTGTGGC 0: 1
1: 0
2: 4
3: 30
4: 375
Right 943637241 2:190319673-190319695 GCCGCTGAAGAGCCTGCCCTTGG 0: 1
1: 0
2: 1
3: 12
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943637235 Original CRISPR GCCACAGTGGGAAAAGGGCC GGG (reversed) Intronic
900011371 1:112521-112543 GCCACAGTCAGAATAGTGCCTGG + Intergenic
900027473 1:289087-289109 GCCACAGTCAGAATAGTGCCTGG + Intergenic
900041430 1:468529-468551 GCCACAGTCAGAATAGTGCCTGG + Intergenic
900062864 1:703506-703528 GCCACAGTCAGAATAGTGCCTGG + Intergenic
900225707 1:1532830-1532852 GCCACTGTGGGTCAGGGGCCTGG - Intronic
901028188 1:6290357-6290379 GCCACAGTGGGGAAAAGCCCAGG - Intronic
901338923 1:8477323-8477345 GCCACAGGGAGAAAAGCTCCTGG + Intronic
901451369 1:9338620-9338642 GTCACAGCTGGAAAAGGGTCTGG + Intronic
903875688 1:26471968-26471990 GCCAAAGTGGGAAAAAGGCGGGG - Intergenic
903998159 1:27321405-27321427 GCCACAGAATGAAAAGGGCAAGG + Intergenic
904036999 1:27564299-27564321 GCCGCAGTGAGAGAAGTGCCAGG + Intronic
905774974 1:40662568-40662590 GCCACAGAGGCAAGAGGGCCAGG + Intronic
905813977 1:40933639-40933661 GCCAGAGTGGCAAAAGGGCAGGG + Intergenic
905915780 1:41683307-41683329 CCCAAAGTGGGAAAAGGCACTGG + Intronic
906201266 1:43961889-43961911 GCCACAGTGAGTAGAGGGCTAGG - Intronic
907590355 1:55660977-55660999 TAAACAGTGGGCAAAGGGCCGGG - Intergenic
907630321 1:56074565-56074587 GCCCCAGTAGGAGAAGAGCCAGG + Intergenic
907765781 1:57409110-57409132 GCCACATGGGGAAAAAGGCCAGG - Intronic
910289730 1:85588485-85588507 GCCACAGTGGGATAGGGCACAGG + Intergenic
911235880 1:95411747-95411769 GCTACAGTTGGAAAAGGGCAGGG - Intergenic
911601407 1:99851941-99851963 GCCAAAGTTGGAAAAAGGCGCGG - Intronic
911951010 1:104173175-104173197 TCCACAGTGTGAAAGGGGACGGG - Intergenic
912015297 1:105027139-105027161 GCCACAGTGGGATAGGGCACCGG + Intergenic
912529203 1:110307900-110307922 GCCAAAAAGAGAAAAGGGCCAGG - Intergenic
914239509 1:145843692-145843714 GCCAGAAAGGGAAAAGGGTCAGG + Intergenic
914845940 1:151283389-151283411 ACCACAGAGGGAAAGGGGGCGGG + Intronic
918132888 1:181644819-181644841 TACCCAGTGGCAAAAGGGCCGGG + Intronic
920198122 1:204243055-204243077 GGGACAATGGGCAAAGGGCCAGG - Intronic
921221741 1:212978491-212978513 GCCCCAGTGGGGAAAGCCCCAGG + Intronic
921377497 1:214489624-214489646 GGCACAGTGGGACAAGTGCTGGG - Intronic
922259810 1:223928531-223928553 GCCACAGTCAGAATAGTGCCTGG + Intergenic
922455147 1:225768334-225768356 GCCCCAGGGGAAGAAGGGCCAGG + Intergenic
922469789 1:225868951-225868973 GCTACAGAGGGAGAAGGGGCAGG + Intronic
922519938 1:226241065-226241087 GCCACAGTGGGAGTAGGGAAGGG + Intronic
923389893 1:233503786-233503808 GCCACAGTGGTGTAAGGTCCAGG - Intergenic
923666380 1:236002106-236002128 GGCACAGTGGGAGAAGCGGCTGG + Intronic
923744720 1:236689585-236689607 GCCAAGGTGGGAGAATGGCCAGG - Intronic
924340974 1:243031093-243031115 GCCACAGTCAGAATAGTGCCTGG + Intergenic
1062907522 10:1188939-1188961 CCCAGCGTGGGAAGAGGGCCTGG - Intronic
1063160755 10:3416403-3416425 GCCACAGTGGGAACAGGACCTGG + Intergenic
1063639490 10:7816144-7816166 GCCACAGTCTGAAAAGGGCCTGG + Intergenic
1064368941 10:14734230-14734252 GCCACTGGGGGAAAATTGCCTGG + Intronic
1066735496 10:38474328-38474350 GCCACAGTCAGAATAGTGCCTGG - Intergenic
1066756446 10:38717138-38717160 ACCACAGTGGGGAAAGGGAGAGG - Intergenic
1066756458 10:38717167-38717189 GGCTCAGTGGGAAGAGGGGCTGG + Intergenic
1067015617 10:42754896-42754918 GCCCCAGTGGGGAAGGGGCAAGG - Intergenic
1067197573 10:44135514-44135536 CCCCCAGTGGGAGAAGGCCCTGG - Intergenic
1067432150 10:46251809-46251831 GCCACAGATGGACAAGGGCCAGG - Intergenic
1067441079 10:46309535-46309557 GCCTCAGATGGACAAGGGCCAGG + Intronic
1067577727 10:47418798-47418820 GCCTCAGATGGACAAGGGCCAGG + Intergenic
1068117572 10:52751481-52751503 GCCTCAGTGGCAAAAAGGCATGG + Intergenic
1072856341 10:98951509-98951531 GCCACATTGTGCACAGGGCCAGG + Intronic
1073126354 10:101152657-101152679 ACCACAGAAGGAAAAGGCCCAGG - Intergenic
1073290639 10:102411649-102411671 GCCACAGTGGCAAAATGGGCTGG - Intronic
1074100414 10:110350191-110350213 GCAGGAGTGGGAAAAGGGCTGGG - Intergenic
1076091200 10:127687547-127687569 GCCTCAGTGGGAATAGTGTCTGG - Intergenic
1076621496 10:131792079-131792101 GCCACAGCAGGAAAAGCGTCTGG + Intergenic
1076623622 10:131808564-131808586 GCCTCAGAGAGCAAAGGGCCAGG + Intergenic
1076740268 10:132479371-132479393 CCCACAGAGGGAAAAGGCCAGGG + Intergenic
1076918011 10:133434249-133434271 GCCACACTGGGAAAAGAATCTGG - Intergenic
1076938009 10:133578326-133578348 GCCACACTGGGAAAAGAATCTGG - Intergenic
1076967704 11:104757-104779 GCCACAGTCAGAATAGTGCCTGG + Intergenic
1077320954 11:1941785-1941807 GCCTCCGTGGGAAGAGGGCATGG + Intergenic
1077352658 11:2100072-2100094 GCCACAGTGGTAGCAGGGCCTGG + Intergenic
1077561280 11:3263298-3263320 GCCACAGTGGGAACAGGACCTGG - Intergenic
1077567176 11:3309127-3309149 GCCACAGTGGGAACAGGACCTGG - Intergenic
1077899347 11:6476939-6476961 GCTATGGTGGGAAGAGGGCCTGG - Exonic
1078070731 11:8107836-8107858 GCCACAGTGCCAAAAGGCCAGGG + Intronic
1079350957 11:19691694-19691716 GCCACAGTGGGAAAAACCCAAGG - Intronic
1082195396 11:49298517-49298539 GCCACAGTAGGATAGGGCCCTGG - Intergenic
1082709984 11:56542847-56542869 GCTACAGTGTGAAAACGTCCAGG - Exonic
1083375205 11:62214711-62214733 GCCCCAGAAGGAAAAGGGACAGG - Intergenic
1084651440 11:70491765-70491787 CACACAGCTGGAAAAGGGCCTGG - Intronic
1086660536 11:89411035-89411057 GCCACAGTAGGATAGGGCCCTGG + Intronic
1086753538 11:90529737-90529759 GCCACAGTGGGGCAGGGGCAGGG - Intergenic
1087181273 11:95144775-95144797 CCCCCAGTGGGGAAAGGGGCTGG + Intergenic
1087803510 11:102530592-102530614 GCTACAGTGGGAACAGGCTCAGG - Exonic
1088481584 11:110300526-110300548 TCCACAGTGTGGAAAGGGACCGG + Intergenic
1088742357 11:112777481-112777503 GCTACAGTGGGCATGGGGCCAGG - Intergenic
1089109055 11:116040204-116040226 GCCACAGTGGAAAATGGGGCTGG + Intergenic
1089464790 11:118678088-118678110 GGCAGAGTGGGAACAGGTCCGGG - Intronic
1089466842 11:118690993-118691015 GGCAGAGTGGGAACAGGTCCAGG - Intergenic
1089518336 11:119047844-119047866 GCCCCAGAGGGAGAGGGGCCTGG + Intronic
1089539901 11:119183478-119183500 GCCACAGAGGGAAAAGGTTTAGG - Exonic
1090239934 11:125174842-125174864 GGCAGAGTGGGAGAGGGGCCGGG - Intronic
1090522135 11:127490532-127490554 TCCACAGTGGGTAAATGGCCCGG - Intergenic
1090964454 11:131585811-131585833 GCCACAGTGGGAAAAAGGAAAGG - Intronic
1091659671 12:2374018-2374040 GCCACAGTGGTCAAGGGACCTGG + Intronic
1092262568 12:6960337-6960359 CCCACAGTCGCAGAAGGGCCAGG + Exonic
1092538556 12:9406244-9406266 GCCAGAGGGGGAAGAGGGGCTGG - Intergenic
1092538677 12:9406691-9406713 GCCACGGGGGGAAGAGGGGCAGG - Intergenic
1093010985 12:14106730-14106752 CATAAAGTGGGAAAAGGGCCAGG + Intergenic
1093084165 12:14848202-14848224 GCCTCAGTGGGAGCCGGGCCTGG - Intronic
1094514898 12:31120478-31120500 GCCAGGGTGGGAAGAGGGGCTGG - Intergenic
1097970294 12:65626053-65626075 GACACAGCAGGAACAGGGCCAGG + Intergenic
1098514162 12:71354389-71354411 GCCACAGTGCAGAAAGGGCAGGG + Intronic
1099190055 12:79553268-79553290 TCCACAGTGTGGAAAGGGTCCGG + Intergenic
1099778617 12:87165822-87165844 GGAACAGTGGGAAGAGGGCCAGG - Intergenic
1100010267 12:89944425-89944447 CCCACAGAGGAAAAAGTGCCTGG - Intergenic
1101211900 12:102543198-102543220 ACAGCAGTGGGAAAAGGACCTGG - Intergenic
1102535325 12:113576715-113576737 GGCACAGGGGGAAAAGTGACAGG + Intergenic
1102821170 12:115910354-115910376 GACACTGTGGAAAAAGAGCCTGG - Intergenic
1103058007 12:117836691-117836713 GCCACAGTTGGCAAGGGGCTGGG - Intronic
1103358982 12:120342578-120342600 GCCGCAGGGGGCAAGGGGCCAGG - Exonic
1103521180 12:121537693-121537715 GTCCCCGTGGGGAAAGGGCCGGG + Intronic
1103701285 12:122849991-122850013 GTCACAGTGGGAAAAGCCCACGG - Intronic
1103745203 12:123118000-123118022 GCCACAGTGTGAAAGGATCCTGG + Intronic
1103886538 12:124206662-124206684 GACACAGTGGGACAAGGACCAGG - Intronic
1103903606 12:124316093-124316115 GCCACACAGGAAAAGGGGCCTGG - Intergenic
1104592878 12:130098754-130098776 GCCAAGGTGTGAAGAGGGCCTGG + Intergenic
1105246011 13:18650867-18650889 GCCTCAGTGGGAAAGGGAGCTGG + Intergenic
1106547798 13:30745376-30745398 CCCACAGAGGGCAAGGGGCCAGG - Intronic
1106656659 13:31753906-31753928 GCCACAGAGAGAAAAGGGTGGGG + Intronic
1107516020 13:41130765-41130787 CCCACAGTGGAAAAAGAACCGGG - Exonic
1107940535 13:45377734-45377756 GCCAGAGGGGGAAGAGGGGCTGG + Intergenic
1107941514 13:45381658-45381680 GCCAGAGGGGGAAGAGGGGCTGG + Intergenic
1107941543 13:45381739-45381761 GCCAGAGGGGGAAGAGGGGCTGG + Intergenic
1107941654 13:45382056-45382078 GCCAGAGGGGGAAGAGGGGCTGG + Intergenic
1107941796 13:45382451-45382473 GCCAGAGGGGGAAGAGGGGCTGG + Intergenic
1108053345 13:46465376-46465398 GCCACGGGGGGAAAAGGGGCTGG - Intergenic
1108053432 13:46465614-46465636 GCCAGAGGGGGAAGAGGGGCTGG - Intergenic
1108053779 13:46467212-46467234 GCCACGGGGGGAAAAGGGGCTGG - Intergenic
1108053836 13:46467371-46467393 GCCAGAGGGGGAAGAGGGGCTGG - Intergenic
1108431144 13:50355037-50355059 ACCACAGTAGGCACAGGGCCAGG - Intronic
1110650675 13:77938211-77938233 GACACAGAGGGAAAGGGTCCGGG + Intergenic
1110892255 13:80707125-80707147 GCCAGGGGGGGAAAAGGGGCTGG - Intergenic
1112314004 13:98344874-98344896 GCCACACTGTAAAAAGGGCTGGG - Intronic
1112332071 13:98484452-98484474 GCTACAGTGGGAGAAGAGGCGGG - Intronic
1112760221 13:102686951-102686973 GCCACAATGGAAACAAGGCCTGG + Exonic
1113361698 13:109637598-109637620 TCCACAGTGGGCAAAAGGACCGG + Intergenic
1113752167 13:112784008-112784030 CCCACAGTGGGGCAAGAGCCTGG + Intronic
1114669239 14:24399993-24400015 GCCAGAGAGGGTAAGGGGCCTGG + Intronic
1114716302 14:24829052-24829074 GGCACAGGGGGCACAGGGCCTGG - Intronic
1115019060 14:28652860-28652882 TCCACAATGGGGAAAGGGCATGG - Intergenic
1116114993 14:40636276-40636298 GCCACAGAGGAAACATGGCCTGG - Intergenic
1116712851 14:48391270-48391292 GGTCCAGTGGGAAAAGGACCAGG - Intergenic
1118592255 14:67410499-67410521 GCCACAGTGGCAAGTGGGCGTGG + Intronic
1118906995 14:70030451-70030473 ACCACAGTGGGAAAAGGAAAGGG + Exonic
1119049950 14:71357465-71357487 TCCACACTGGGAAAAGCTCCTGG + Intronic
1119429640 14:74557992-74558014 GCCCAAGTGGGATAAGGCCCTGG + Intronic
1119511418 14:75214447-75214469 GCCACAGGTGGAAAAAGGCTAGG + Intergenic
1119728273 14:76935428-76935450 GTCAAAGTGGGGAATGGGCCTGG - Intergenic
1119991846 14:79207057-79207079 GCCTCAGAGGCAAGAGGGCCAGG - Intronic
1120847265 14:89137719-89137741 GCACCAGTGGGCAAAGGGCCAGG + Intronic
1122161838 14:99790795-99790817 GCCAAAGTTGGCAGAGGGCCAGG - Intronic
1122211788 14:100178365-100178387 GCCACAGAGGGTGAATGGCCTGG + Intergenic
1123440712 15:20289203-20289225 ACCACAGTGGGGAAAGGGAGAGG - Intergenic
1125542247 15:40476341-40476363 GCGAGAGTGGGAAGAGGGGCGGG - Intergenic
1126143156 15:45454008-45454030 GCCACGGTGGGAAACCTGCCAGG - Intergenic
1129322824 15:74784042-74784064 GCCACAGCAGGAACAGGGCAAGG + Intronic
1130063251 15:80584474-80584496 GGCACAGTGGGAAAGGGTGCAGG + Intronic
1131098693 15:89671697-89671719 GCGAAAGAGGGCAAAGGGCCTGG - Intronic
1131369341 15:91866873-91866895 GCCAGGGTGGGAGATGGGCCTGG + Intronic
1132127034 15:99236681-99236703 TAAAAAGTGGGAAAAGGGCCAGG - Intronic
1132286649 15:100668445-100668467 GCCACAGGGGGCTCAGGGCCAGG - Intergenic
1133026681 16:2991679-2991701 GCCACAGAGGGACGAGTGCCTGG - Intergenic
1133767766 16:8849711-8849733 GCCACTGTGGGAACTGGGGCAGG - Intergenic
1135123092 16:19783589-19783611 CCAAGAGAGGGAAAAGGGCCTGG + Intronic
1136491271 16:30609970-30609992 GACCCAGTCGGAAAAGGGGCAGG - Exonic
1136513504 16:30753776-30753798 TGCACAGTGGGCAGAGGGCCAGG + Intronic
1136726142 16:32359187-32359209 ACCACAGTGGGGAAAGGGAGAGG + Intergenic
1136938507 16:34499262-34499284 GCCACGGTGGCAAAAAGGCGCGG + Intergenic
1136961311 16:34849295-34849317 GCCACGGTGGCAAAAAGGCGCGG - Intergenic
1137765576 16:50975232-50975254 GCCAAAGTGGGGAAGGGGCCTGG - Intergenic
1139480690 16:67228984-67229006 CCCACAGGAGGTAAAGGGCCCGG - Exonic
1139654631 16:68379976-68379998 GTCACCGTGGCACAAGGGCCTGG - Intronic
1142236542 16:88925154-88925176 TCCGCAGTGGGCAGAGGGCCGGG + Intronic
1142452977 16:90194382-90194404 GCCACAGTCAGAATAGTGCCTGG - Intergenic
1203000289 16_KI270728v1_random:158569-158591 ACCACAGTGGGGAAAGGGAGAGG - Intergenic
1203131891 16_KI270728v1_random:1694972-1694994 ACCACAGTGGGGAAAGGGAGAGG - Intergenic
1143187798 17:5020960-5020982 GCCAGAGTGGGAAATGGGCATGG + Intronic
1143880073 17:10023159-10023181 GCCACATTAGGAGATGGGCCTGG - Intronic
1146671546 17:34741351-34741373 GTCACAGTGGGAACAAAGCCAGG + Intergenic
1147426814 17:40349726-40349748 CCCACAGTGGGAGCAGTGCCTGG - Intronic
1147924133 17:43936199-43936221 GCCTCAGAGGGAAAGGGGGCAGG + Intergenic
1148381860 17:47205618-47205640 GCCCCAGTGAAAAAAGTGCCTGG - Intronic
1148895416 17:50836500-50836522 GCCACAGTGTGAGATGGACCAGG + Intronic
1148895440 17:50836617-50836639 GCCACAGTGTGAGATGGACCAGG + Intronic
1148895464 17:50836734-50836756 GCCACAGTGTGAGATGGACCAGG + Intronic
1150986892 17:70208340-70208362 GCCACAGGGGGAAAATGTGCTGG - Intergenic
1151310575 17:73290283-73290305 GCCAGAGCTGGAGAAGGGCCTGG - Intronic
1151349443 17:73522962-73522984 GCCACAGCCGGGACAGGGCCTGG - Intronic
1151536512 17:74741926-74741948 ACCGAAGTGGGAAAAGGGCAGGG + Intronic
1151550656 17:74820756-74820778 AGCACAGTGGGAAACGGGGCTGG - Intronic
1151868424 17:76820301-76820323 ACCACAGTGGGAAAGATGCCAGG + Intergenic
1152037620 17:77883168-77883190 CCTAGAGTGGGAAAATGGCCTGG + Intergenic
1152113555 17:78370942-78370964 GCCCAGGTGGGAAAAGGGACAGG - Intergenic
1152390914 17:80003174-80003196 GCCACAGGTGGGCAAGGGCCAGG - Intronic
1152794712 17:82301357-82301379 GCCGAGGTGGGGAAAGGGCCAGG + Intergenic
1152923456 17:83077238-83077260 GCCCCAGGGTGGAAAGGGCCAGG + Intergenic
1153016259 18:584871-584893 GCCACAGCCTGAGAAGGGCCTGG - Intergenic
1157450214 18:47780629-47780651 TCCACAGTTGGGGAAGGGCCTGG - Intergenic
1157649850 18:49317448-49317470 GCAACAGTGAGAAGTGGGCCTGG + Intronic
1158606694 18:58902099-58902121 GCCACAATGTGACATGGGCCAGG - Intronic
1158878316 18:61753148-61753170 GCAGCAGTGGGCAAAGAGCCTGG + Intergenic
1160383641 18:78479715-78479737 GGCACAGTGGGCAGAGGGCACGG - Intergenic
1160390616 18:78528638-78528660 GCCACAGTCAGAAGAGGTCCCGG + Intergenic
1160644508 19:174380-174402 GCCACAGTCAGAATAGTGCCTGG + Intergenic
1160699627 19:499651-499673 GCCACAGTGGGAGAAGGTCATGG - Intronic
1160820340 19:1054896-1054918 GCCAGAGAGGGGAAAGGTCCAGG - Intronic
1161003525 19:1923277-1923299 GACACCGTGGGGAGAGGGCCCGG - Intronic
1161086178 19:2335761-2335783 GACACAGTGGGAAAGGAGGCGGG - Intronic
1161482163 19:4516675-4516697 GCCACTGTGGGGACAGGGGCCGG + Exonic
1161572355 19:5037511-5037533 GCCACAGTGCAAAAGGCGCCTGG - Intronic
1162461562 19:10816929-10816951 GCAGCAGTGGGAGAAGGGCCGGG + Intronic
1165441930 19:35833392-35833414 TCCACAGTGGGCACATGGCCCGG + Intronic
1165486086 19:36097058-36097080 GCCACTGTGGGCAAAGCGGCTGG + Exonic
1166486469 19:43218292-43218314 GCCACTGTGGAAAAATGGCATGG + Intronic
1166738401 19:45099570-45099592 GTCACAGTGTGCAAAGGGCCTGG - Intronic
1167034250 19:46984400-46984422 ACCACAGCAGGAAAAGGGCTGGG - Intronic
1167233394 19:48298842-48298864 GGCACAGTGGGGAGAGGCCCTGG - Intronic
1168121181 19:54253419-54253441 GGCAGAGTGGGAAACGGACCTGG - Intronic
925713868 2:6767578-6767600 GCCATACTGGGGGAAGGGCCTGG - Intergenic
925902208 2:8516627-8516649 ACAAGAGTGGGAAAAGGTCCTGG - Intergenic
926096708 2:10085937-10085959 GCCACAGTCGGTAAATGGTCAGG - Intronic
926112573 2:10192563-10192585 GCCTAAGTGGAAAAGGGGCCGGG + Intronic
926225675 2:10965329-10965351 GCCAGAGTGGGAAACAGGCAAGG - Intergenic
927277077 2:21271486-21271508 GTCACAGAGGGAGAAGGGTCAGG - Intergenic
927476771 2:23419788-23419810 GCCTGAGTGGGGAAAAGGCCAGG - Intronic
928078710 2:28288934-28288956 CCCACAGTGGGTAGAGTGCCAGG - Intronic
928253801 2:29704752-29704774 GCCACAGTGAGAACAGGGTGGGG + Intronic
929374124 2:41263538-41263560 GACACATTTGGAAAAGGGCCTGG + Intergenic
929886543 2:45883784-45883806 GCCACTGTGGGAACAGGGTATGG + Intronic
929995536 2:46823950-46823972 GCCACAATGGGAAGGGTGCCTGG + Intronic
934319745 2:91961394-91961416 ACCACAGTGGGGAAAGGGAGAGG - Intergenic
934565764 2:95339902-95339924 GCCACAGGGTAGAAAGGGCCTGG - Intronic
934681536 2:96287229-96287251 GCCACTGTGGGAAAGGGGTAGGG + Intronic
936249068 2:110853321-110853343 CCCAAAATGGGAAAAGTGCCTGG + Intronic
938264475 2:129916776-129916798 GCCATAGCGGGAAAATGGCTTGG - Intergenic
940857683 2:158742262-158742284 GGCACACTTGGAAGAGGGCCAGG - Intergenic
941253238 2:163194399-163194421 GCTACATTAGGAAAATGGCCAGG - Intergenic
943376083 2:187078458-187078480 GTCACAGTGGGTCTAGGGCCAGG - Intergenic
943637235 2:190319646-190319668 GCCACAGTGGGAAAAGGGCCGGG - Intronic
944523709 2:200597332-200597354 CATACAGTGGGAAAGGGGCCAGG - Intronic
944653155 2:201851952-201851974 TAAACAGTGGGCAAAGGGCCGGG - Intronic
946832107 2:223737447-223737469 ACCAGACTGGGAAAAGGGCAGGG - Intergenic
948052554 2:234989504-234989526 TACGCAGTGGGCAAAGGGCCAGG - Intronic
948271216 2:236674536-236674558 GCCACAGTGGGGAAGAGACCGGG + Intergenic
948601746 2:239111463-239111485 GCCACAGTGGGCACAGCGCGGGG - Intronic
948754424 2:240150711-240150733 ACCCCAGTGGGAAAACGGCCTGG - Intergenic
949084417 2:242139045-242139067 GCCACAGTCAGAATAGTGCCTGG - Intergenic
1169142908 20:3236165-3236187 GACACTGGGGGAACAGGGCCTGG - Intronic
1169895014 20:10494730-10494752 GACAAAGTGGGAGTAGGGCCAGG - Intronic
1170927504 20:20738799-20738821 GCCTTTGTAGGAAAAGGGCCAGG - Intergenic
1170943141 20:20865668-20865690 GACACAGTGGGAAAAGGAGAAGG - Intergenic
1170978575 20:21189615-21189637 GCCAAAGTGGGGAAAAGGCAAGG + Intronic
1171439275 20:25147881-25147903 GCCACAGGTAGAAGAGGGCCCGG + Intergenic
1172704490 20:36872995-36873017 ACCAGAGTGGGCACAGGGCCAGG + Intergenic
1173010691 20:39179042-39179064 GCGAAAGGGGAAAAAGGGCCAGG + Intergenic
1174342327 20:49905799-49905821 GCCACAGCGGGAAGTGGGCGTGG + Exonic
1174450752 20:50618610-50618632 GCCACAGAGGAAAACAGGCCAGG - Intronic
1174763688 20:53231447-53231469 GCCACACTGAGAAATGGCCCTGG + Intronic
1175347994 20:58296514-58296536 TGCACAGTAGGAAAAGGGCTTGG + Intergenic
1175979019 20:62727808-62727830 GCCAGAGTGGGAGAAGAGCAAGG + Intronic
1176120814 20:63453748-63453770 GCCACAGGGGGAGAAGGGGAAGG + Intronic
1176280999 20:64311528-64311550 GCCACAGTCAGAATAGTGCCTGG - Intergenic
1176453177 21:6882407-6882429 GCCTCAGTGGGAAAGGGAGCTGG + Intergenic
1176831350 21:13747455-13747477 GCCTCAGTGGGAAAGGGAGCTGG + Intergenic
1180230594 21:46424694-46424716 GGCGCAGTGGGAGCAGGGCCGGG - Intronic
1180307995 22:11145438-11145460 ACCACAGTGGGGAAAGGGAGAGG - Intergenic
1180546471 22:16507251-16507273 ACCACAGTGGGGAAAGGGAGAGG - Intergenic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1181033593 22:20159530-20159552 GCCAGAGTAGGAAAAAGGCAGGG - Intergenic
1181469098 22:23127107-23127129 CCCACAGTGGCAACAGGCCCTGG + Intronic
1181509713 22:23383714-23383736 GCCAGAGTGGGGAAAAGGCAGGG + Intergenic
1181628468 22:24137336-24137358 AGCCCAGTGGGAAAGGGGCCTGG - Intronic
1181887375 22:26031934-26031956 GACACACGGGGAAAGGGGCCAGG + Intergenic
1182146105 22:27997774-27997796 GCCACTGAGGGAACAGGCCCAGG + Intronic
1182212718 22:28690128-28690150 ACCACAGTGGGGAAAGGGAGAGG + Intronic
1182512634 22:30829925-30829947 GCCAAAGTGGGAGCAGGGCTTGG + Intronic
1183258847 22:36781155-36781177 GACACAGTGGCAAAGGGGCTTGG - Intergenic
1183980570 22:41537464-41537486 GGAGCAGTGGGAACAGGGCCTGG + Intronic
1184153162 22:42649850-42649872 TCCACAGTGGGACAATGGCGTGG - Intergenic
1184478149 22:44732395-44732417 GGCACAGTGGGCAGAGGGTCGGG + Intronic
1184841398 22:47054435-47054457 GGCAGAGTGGGAAGTGGGCCGGG - Intronic
1185161693 22:49233845-49233867 GGCACAGTGAGAAAAATGCCAGG + Intergenic
1185181604 22:49366619-49366641 GCCACGGTGGGTCCAGGGCCCGG + Intergenic
1185408802 22:50672367-50672389 GCCACAGTGGGATGAAGGGCCGG + Intergenic
949350577 3:3121473-3121495 GCCAGAGTGGGAAAAAGGAGTGG - Intronic
949563136 3:5221076-5221098 TCCACAGATGGCAAAGGGCCTGG - Intergenic
949883198 3:8677062-8677084 GCCACAGGGGGAAGAGGGGCTGG - Intronic
949883978 3:8680308-8680330 GCCAGAGAGGGAAGAGGGGCTGG - Intronic
950183886 3:10933390-10933412 CCAACAGTGGGAAAAGGCCAAGG - Intronic
952132855 3:30384745-30384767 GCCACAGTAGGATAAGGCACTGG - Intergenic
954724552 3:52596677-52596699 GCCACAGTAGGATAAGGCACTGG - Intronic
955986015 3:64574777-64574799 GCTACACTGGAAAAATGGCCTGG + Intronic
956997130 3:74839909-74839931 GCGACAGCTGTAAAAGGGCCTGG - Intergenic
957392588 3:79596376-79596398 GCCAAAGTGGGAAGAGGATCAGG + Intronic
957702193 3:83728277-83728299 GCAACAGTGGGAAAAGAACTTGG + Intergenic
958172466 3:89955170-89955192 GCCAGTGTGGGAAAAAGGCAGGG + Intergenic
959920711 3:111865315-111865337 AACATAGTGGGAAAAAGGCCTGG - Intronic
961356557 3:126343385-126343407 AGCCCAGTGGGAGAAGGGCCAGG + Exonic
962740666 3:138360839-138360861 GGGACAGTGGACAAAGGGCCAGG - Intronic
966612707 3:181883747-181883769 GACAGAGAGGGAAAAGGGCTGGG - Intergenic
968605470 4:1533120-1533142 GCCACAGTGGCCAAGGGGCTTGG + Intergenic
968662338 4:1803963-1803985 CCCACACTGGGCACAGGGCCAGG - Intronic
969621525 4:8281188-8281210 GCCACTGTGGGGGCAGGGCCCGG - Intronic
969731188 4:8959096-8959118 GCCAGGGTGGGAAGAGGGGCTGG - Intergenic
969790474 4:9491047-9491069 GCCAGAGGGGGAAGAGGGGCTGG - Intergenic
969858425 4:10018132-10018154 GGCACAATGTGAAGAGGGCCTGG + Intronic
975292151 4:72689402-72689424 GCCACAGTGGGAAAAGAAGGGGG + Intergenic
975705787 4:77110847-77110869 GCCACTGTGAGAAAAGGGCGGGG - Intergenic
977345590 4:95812257-95812279 CCCACTGTGGGAAAGGGGCAGGG + Intergenic
977957918 4:103051850-103051872 GCTTCAGTGGGAAAATGTCCAGG - Intronic
978503423 4:109433422-109433444 GCCTCAGTGGGTGAAGGGACCGG - Intergenic
979261848 4:118657283-118657305 GCCACAGTCAGAATAGTGCCTGG - Intergenic
979642465 4:123024898-123024920 GACACACTGGGAGAAGGACCAGG - Intronic
983149976 4:164266039-164266061 GCCACAGTCAGAATAGTGCCTGG + Intronic
983212141 4:164969826-164969848 GCAAAAGTGGCAAAAGGGGCAGG + Exonic
983992780 4:174141682-174141704 GCCACATTGGCAAACTGGCCTGG + Intergenic
985973331 5:3394189-3394211 GCCACAGAGGCAAGATGGCCTGG + Intergenic
986635108 5:9813430-9813452 AGCAAAGTGGGAGAAGGGCCAGG - Intergenic
987230238 5:15886385-15886407 GCCATAGTGAGAAAAGAGCAAGG - Intronic
991657919 5:68921657-68921679 TCCACAGTGTGGAAAGGGACCGG - Intergenic
991975379 5:72179469-72179491 TTCACACTGGGAAACGGGCCAGG - Intronic
992905875 5:81345146-81345168 GCAACAGGAGGATAAGGGCCTGG + Intronic
993554768 5:89322488-89322510 GCAACATTGGGAAAAGAGCAGGG - Intergenic
997623005 5:135312097-135312119 GCCAAACAGGGAATAGGGCCTGG + Intronic
997624120 5:135320084-135320106 GCCACCGTGGGCAGTGGGCCTGG - Intronic
998070689 5:139195680-139195702 ATAACAGTGGGAATAGGGCCGGG - Intronic
999751260 5:154629669-154629691 GCCACAGTGTTCACAGGGCCAGG + Intergenic
1000252696 5:159510525-159510547 CTTACAGTGGGAACAGGGCCTGG - Intergenic
1002089832 5:176797931-176797953 GGCACAGGGGGAATAGGGGCTGG + Intergenic
1002197826 5:177510665-177510687 GCCACAGTGGGCACAGAGCTGGG - Intronic
1002472033 5:179441033-179441055 GCCACAGTGGGAGACCAGCCTGG + Intergenic
1002732416 5:181350399-181350421 GCCACAGTCAGAATAGTGCCTGG - Intergenic
1002752123 6:123707-123729 GCCACAGTCAGAATAGTGCCTGG + Intergenic
1003620670 6:7696643-7696665 GCCAGAGTGGGTACAGGGCCAGG - Intergenic
1005450765 6:25969768-25969790 TCCACTGTGGTAAAAGTGCCAGG - Intronic
1005620731 6:27617778-27617800 TCCACAAGGGGAAAGGGGCCGGG - Intergenic
1005817019 6:29561735-29561757 GAGACAGTGGGAAAAATGCCAGG + Intronic
1006189985 6:32201751-32201773 CTCACAGAGGGAAAAGGGCCTGG - Intronic
1006237182 6:32643853-32643875 GTGACAATGGGAAAAGGGACGGG + Intronic
1006885941 6:37382407-37382429 GCCACACTGGGAACTGGGGCAGG - Intronic
1007072630 6:39048504-39048526 GCCAGGGTGGGAGGAGGGCCTGG + Intergenic
1011627035 6:89291165-89291187 GCTACAGAGGGAAGAGAGCCAGG - Intronic
1012491279 6:99785024-99785046 GCAAGAGAGGGAAGAGGGCCAGG + Intergenic
1018809481 6:167287518-167287540 ACCACACTGATAAAAGGGCCAGG - Intronic
1019236668 6:170622715-170622737 GCCACAGTCAGAATAGTGCCTGG - Intergenic
1019905055 7:4056554-4056576 CCCACTGTGGGAAAAGGGAAAGG + Intronic
1020016292 7:4834032-4834054 GCCACAGTGTCCACAGGGCCGGG + Intronic
1021806467 7:24361826-24361848 CCCACAGAGGGAAAAGGAGCAGG - Intergenic
1023099286 7:36697863-36697885 CACACAGAGGGAAAATGGCCAGG + Intronic
1023646223 7:42318725-42318747 GCCACAGTGGGATAGGGCACCGG + Intergenic
1024443973 7:49454487-49454509 TCCACAGTGTGGAAAGGGACCGG - Intergenic
1024654282 7:51435914-51435936 GTCCCAAAGGGAAAAGGGCCAGG - Intergenic
1024877116 7:54038036-54038058 AAGACAGTGGGAAAAAGGCCTGG - Intergenic
1026287182 7:68973614-68973636 GACACAGTTGGGAAAGGGGCCGG - Intergenic
1028160884 7:87483593-87483615 GCCACAGTAGGATAGGGGACTGG + Intergenic
1028334937 7:89640214-89640236 GAAACAGTGGAAAAAGGGCATGG - Intergenic
1029637148 7:101792612-101792634 GCGCCAGTGTGAAAAGAGCCGGG - Intergenic
1034303171 7:150033632-150033654 GCCAGAGGGGGAAAAGGGAGTGG + Intergenic
1034305109 7:150040837-150040859 GCCAGAGGGGGAAGAGGGGCTGG + Intergenic
1034305741 7:150043361-150043383 GCCAGAGGGGGAAGAGGGGCTGG + Intergenic
1034399486 7:150852658-150852680 GACACAGAGGGAGGAGGGCCAGG + Intronic
1034489489 7:151385741-151385763 CTCACAGTGAGAAGAGGGCCCGG + Intronic
1034801102 7:154057289-154057311 GCCAGAGGGGGAAGAGGGGCTGG - Intronic
1034801583 7:154059065-154059087 GCCAGAGGGGGAAGAGGGACTGG - Intronic
1034801951 7:154060446-154060468 GCCAGAGGGGGAAGAGGGTCTGG - Intronic
1034922978 7:155098955-155098977 CCCACAGGAGGAAATGGGCCTGG + Intergenic
1035164112 7:156974140-156974162 GCCACAGTGGGGAGAGGGGGAGG - Intergenic
1035511104 8:183893-183915 GCCACAGTCAGAATAGTGCCTGG + Intergenic
1036272736 8:7322231-7322253 GCCACAGTAGGATAGGGCCCTGG + Intergenic
1036348612 8:7988117-7988139 GCCACAGTAGGATAGGGCCCTGG - Intergenic
1036658222 8:10691253-10691275 GCCACAGTGGGGCATCGGCCAGG + Intronic
1039521062 8:38172234-38172256 GGCAGAGTGGGAAAAGGACAGGG + Intronic
1041426271 8:57724014-57724036 GCCACAGTGGGAAAAAGTGTGGG - Intergenic
1041896327 8:62928754-62928776 GCCACAGTATCAAACGGGCCTGG + Intronic
1042919143 8:73905419-73905441 GGAGCAGTGGGAACAGGGCCAGG - Intergenic
1046338112 8:112816430-112816452 GCCACGGTATGAAAAGGGCTTGG - Intronic
1048499468 8:134962463-134962485 GCCACAGTGGGAATGGGACAGGG - Intergenic
1048581880 8:135735633-135735655 GCAGCAGTGGGACAAGGGGCGGG - Intergenic
1049644113 8:143728446-143728468 GCCACCCCGGGAAGAGGGCCTGG - Exonic
1049683453 8:143930025-143930047 GCCACAGCGTGACCAGGGCCTGG + Exonic
1050119235 9:2291277-2291299 TCCACAGAGGGAAAAGGGCGGGG - Intergenic
1051434224 9:17013776-17013798 GCCTGAGTGGGAGAAAGGCCAGG + Intergenic
1051821825 9:21179138-21179160 GCCACAGTGGCAAAGCGGCAGGG + Intergenic
1052943885 9:34151773-34151795 GCCTCAGTGGCAAAAAGGTCAGG + Intergenic
1053304159 9:36972285-36972307 GGCCCAGTGGGAAAAGGGTTGGG + Intronic
1053307562 9:36995143-36995165 GCCACACTGGGAAAAGGAGATGG + Intronic
1053409461 9:37906173-37906195 GACAGACTGGCAAAAGGGCCAGG - Intronic
1057747451 9:97763302-97763324 GACACAGCAGGAAAAGTGCCTGG - Intergenic
1057979890 9:99650250-99650272 GCTACAGTGGGAGGAGGGCATGG - Intergenic
1058785263 9:108380851-108380873 GCAACAATGGGAAGAGGGCATGG - Intergenic
1060861255 9:126956587-126956609 GCCACAGGGGGAAGATGGGCAGG + Intronic
1061230604 9:129313625-129313647 GACACAGTGAGAATGGGGCCAGG + Intergenic
1061272348 9:129550456-129550478 GCGCCAGTGGGGAGAGGGCCGGG - Intergenic
1061903756 9:133686066-133686088 GCCACAGTGCTATGAGGGCCCGG + Intronic
1062173043 9:135145860-135145882 GGCAGAGTGGGAAAGAGGCCTGG - Intergenic
1062273810 9:135721405-135721427 GCCCCAGGGCGAGAAGGGCCAGG - Intronic
1062276238 9:135732844-135732866 CCCCCAGTGGGAGAAGGGCATGG - Intronic
1062345341 9:136111871-136111893 GTCACTGTGGACAAAGGGCCTGG + Intergenic
1062474162 9:136719286-136719308 CCCCCACTGGGCAAAGGGCCAGG - Intronic
1062732196 9:138116376-138116398 GCCACAGTGGGAAAAAGTGATGG - Intronic
1062756818 9:138302726-138302748 GCCACAGTCAGAATAGTGCCTGG - Intergenic
1203516004 Un_GL000213v1:2108-2130 GCCTCAGTGGGAAAGGGAGCTGG - Intergenic
1185734858 X:2488916-2488938 GCAGCAGGGGGAAGAGGGCCAGG + Exonic
1187075580 X:15931177-15931199 GCCACAGTGGAAAAAAGGCATGG + Intergenic
1187575356 X:20547916-20547938 GCCACAGTGGAAAATGGTGCTGG + Intergenic
1190740540 X:53285597-53285619 GGAACAGTGAGAAAAGGGCAGGG + Intronic
1190998501 X:55636082-55636104 GACTCAGAGGGAGAAGGGCCTGG - Intergenic
1192659873 X:73030770-73030792 GCCACAGTTGGGGAAGGGCTTGG - Intergenic
1194617621 X:96126074-96126096 TCCACAGTAAGAAAAGGGCAGGG - Intergenic
1196775360 X:119332955-119332977 TCCACAGTGTGAAAGGGGACTGG - Intergenic
1197093973 X:122572079-122572101 GGCACAGTGGGAAAAGGTTGTGG - Intergenic
1198242395 X:134798496-134798518 GCAACAATGAGAAAGGGGCCAGG - Intronic
1199478545 X:148273254-148273276 GCCACAGTAGGTAAAGCTCCTGG - Intergenic
1201187268 Y:11416486-11416508 ACCACAGTGGGGAAAGGGAGAGG - Intergenic
1202383939 Y:24305748-24305770 GCCACAGTCAGAATAGTGCCTGG - Intergenic
1202486844 Y:25364372-25364394 GCCACAGTCAGAATAGTGCCTGG + Intergenic