ID: 943637392

View in Genome Browser
Species Human (GRCh38)
Location 2:190320946-190320968
Sequence GGTTTCACACACATGAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943637392_943637395 7 Left 943637392 2:190320946-190320968 CCTAGCTTCATGTGTGTGAAACC No data
Right 943637395 2:190320976-190320998 CACAAGGCCTCATCGTTAGAAGG No data
943637392_943637393 -9 Left 943637392 2:190320946-190320968 CCTAGCTTCATGTGTGTGAAACC No data
Right 943637393 2:190320960-190320982 TGTGAAACCTGAGTCTCACAAGG No data
943637392_943637396 8 Left 943637392 2:190320946-190320968 CCTAGCTTCATGTGTGTGAAACC No data
Right 943637396 2:190320977-190320999 ACAAGGCCTCATCGTTAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943637392 Original CRISPR GGTTTCACACACATGAAGCT AGG (reversed) Intronic
No off target data available for this crispr