ID: 943639541

View in Genome Browser
Species Human (GRCh38)
Location 2:190343642-190343664
Sequence CGCTGCCGCCTCGGGGCTCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 278}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943639541_943639550 12 Left 943639541 2:190343642-190343664 CCGGGAGCCCCGAGGCGGCAGCG 0: 1
1: 0
2: 2
3: 34
4: 278
Right 943639550 2:190343677-190343699 CCGCGGTCCCGCGGGAAAGCCGG 0: 1
1: 0
2: 0
3: 3
4: 73
943639541_943639558 26 Left 943639541 2:190343642-190343664 CCGGGAGCCCCGAGGCGGCAGCG 0: 1
1: 0
2: 2
3: 34
4: 278
Right 943639558 2:190343691-190343713 GAAAGCCGGGGGCGGCGGCCTGG 0: 1
1: 1
2: 4
3: 26
4: 282
943639541_943639545 -5 Left 943639541 2:190343642-190343664 CCGGGAGCCCCGAGGCGGCAGCG 0: 1
1: 0
2: 2
3: 34
4: 278
Right 943639545 2:190343660-190343682 CAGCGCGCGTTTCCACGCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 24
943639541_943639546 3 Left 943639541 2:190343642-190343664 CCGGGAGCCCCGAGGCGGCAGCG 0: 1
1: 0
2: 2
3: 34
4: 278
Right 943639546 2:190343668-190343690 GTTTCCACGCCGCGGTCCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 20
943639541_943639557 21 Left 943639541 2:190343642-190343664 CCGGGAGCCCCGAGGCGGCAGCG 0: 1
1: 0
2: 2
3: 34
4: 278
Right 943639557 2:190343686-190343708 CGCGGGAAAGCCGGGGGCGGCGG 0: 1
1: 0
2: 1
3: 45
4: 396
943639541_943639551 13 Left 943639541 2:190343642-190343664 CCGGGAGCCCCGAGGCGGCAGCG 0: 1
1: 0
2: 2
3: 34
4: 278
Right 943639551 2:190343678-190343700 CGCGGTCCCGCGGGAAAGCCGGG 0: 1
1: 0
2: 1
3: 3
4: 53
943639541_943639547 4 Left 943639541 2:190343642-190343664 CCGGGAGCCCCGAGGCGGCAGCG 0: 1
1: 0
2: 2
3: 34
4: 278
Right 943639547 2:190343669-190343691 TTTCCACGCCGCGGTCCCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 45
943639541_943639552 14 Left 943639541 2:190343642-190343664 CCGGGAGCCCCGAGGCGGCAGCG 0: 1
1: 0
2: 2
3: 34
4: 278
Right 943639552 2:190343679-190343701 GCGGTCCCGCGGGAAAGCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 38
943639541_943639553 15 Left 943639541 2:190343642-190343664 CCGGGAGCCCCGAGGCGGCAGCG 0: 1
1: 0
2: 2
3: 34
4: 278
Right 943639553 2:190343680-190343702 CGGTCCCGCGGGAAAGCCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 51
943639541_943639554 18 Left 943639541 2:190343642-190343664 CCGGGAGCCCCGAGGCGGCAGCG 0: 1
1: 0
2: 2
3: 34
4: 278
Right 943639554 2:190343683-190343705 TCCCGCGGGAAAGCCGGGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943639541 Original CRISPR CGCTGCCGCCTCGGGGCTCC CGG (reversed) Exonic
900168758 1:1255899-1255921 CTCCCCTGCCTCGGGGCTCCTGG + Intronic
900193579 1:1362138-1362160 CCCTGCCTCCTCGGGGCTGCAGG - Intergenic
900335473 1:2160923-2160945 TGCTGCCTCCTCAGGGCTGCAGG + Intronic
900438823 1:2643443-2643465 AGCCGCCTCCTCTGGGCTCCGGG + Intronic
900498258 1:2986710-2986732 GGCTGCCCCCTCGGGGCACAGGG + Intergenic
901425648 1:9181163-9181185 CCCAGCCACCTCTGGGCTCCAGG + Intergenic
901641484 1:10695082-10695104 GCCTGCGGGCTCGGGGCTCCTGG + Intronic
901941647 1:12666743-12666765 CCCTTCCTCCTCGGGGCCCCAGG - Exonic
902323731 1:15684743-15684765 CTCTACCGGCCCGGGGCTCCCGG - Intronic
902546628 1:17194355-17194377 CTCTGGGGCCTCGGGGCTCCTGG + Intergenic
903468473 1:23568472-23568494 CGCTGGGGCCGCGGGGGTCCGGG - Intergenic
904050167 1:27634157-27634179 CTGGGCCGCCGCGGGGCTCCGGG - Intronic
904620592 1:31772854-31772876 CGGGGCCGTCTCTGGGCTCCGGG + Intergenic
904744470 1:32702630-32702652 CCCCGCCGCGCCGGGGCTCCGGG + Exonic
905179147 1:36156001-36156023 GGCTGCGGGCGCGGGGCTCCGGG + Intronic
905569329 1:38991438-38991460 CGCCGCCGCTTCGGGGAGCCGGG - Exonic
906319238 1:44806399-44806421 CGGTGCCCCCTCTGGGCTCAAGG - Exonic
906762265 1:48386875-48386897 CCCTGCTGCCACTGGGCTCCAGG - Intronic
906964224 1:50440813-50440835 TGCTGCTGCCTTGGGTCTCCAGG - Exonic
907913652 1:58849090-58849112 GGCTGCAGCCTTTGGGCTCCAGG + Intergenic
909352749 1:74673660-74673682 CGCCGCCGCCCCTGGGCGCCCGG + Exonic
911188489 1:94926560-94926582 GGCTGGCGCCGCGGGACTCCAGG + Intronic
914201220 1:145487279-145487301 AGCCGCCGCCTCGAGGCTCAGGG + Intergenic
914480335 1:148060411-148060433 AGCCGCCGCCTCGAGGCTCAGGG + Intergenic
918215734 1:182391131-182391153 GGCTCCCGCCTCGGGGTCCCGGG - Intronic
919640305 1:200039539-200039561 CTCCGCCTCCTCGGGGCTGCCGG - Intronic
920039412 1:203085818-203085840 CCCTGGGGCCTCGGGGCTCAGGG + Exonic
920260518 1:204685190-204685212 AGCAGCCGCCTCAGGGCTCCTGG - Intronic
920704851 1:208243604-208243626 CGCTGCCGACTCCGAGCGCCCGG + Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
921909083 1:220528292-220528314 CGCCGCCGCCGCTGGGCCCCGGG + Intronic
922991976 1:229921829-229921851 GGCTTCTGCCCCGGGGCTCCAGG - Intergenic
1064022902 10:11823682-11823704 CGCTGCCTCCTCGGGGACCTCGG + Intronic
1064254526 10:13732685-13732707 CTCTGCCACCTCGAGCCTCCAGG - Intronic
1066180551 10:32957827-32957849 CGCTGTCACGTCGGGGCTGCCGG - Exonic
1066228477 10:33408066-33408088 AGCTGCCTCTTCGGGGCACCTGG - Intergenic
1066406904 10:35127071-35127093 CGCTGCCGGCTCCGGGTTGCTGG + Intronic
1070792084 10:79195557-79195579 TGCCTCCGCCTCCGGGCTCCTGG - Intronic
1071142969 10:82534337-82534359 CGCTGCAACCTCCGCGCTCCCGG + Intronic
1071573763 10:86711628-86711650 GGCTGCGGCCGCGGCGCTCCGGG - Intronic
1071966564 10:90857999-90858021 CGCTGCCGCCCGGGCGCTCTCGG - Intergenic
1073577804 10:104640464-104640486 CGCTGCCGCGTGGGGGCACCTGG - Intergenic
1075149641 10:119915433-119915455 CACTGCCGGCTCCAGGCTCCAGG - Intronic
1075334435 10:121598263-121598285 AGCTGCGGCCTCGGGGCCCCCGG + Exonic
1076374234 10:129972834-129972856 CGCGGCCGCCTGGGGGCCGCGGG + Intergenic
1076848176 10:133080265-133080287 CGCTGCCGGCTCTGGTCCCCAGG + Intronic
1077008377 11:369544-369566 CGCTCCCGGCTCCGCGCTCCTGG - Intergenic
1077109747 11:856942-856964 CGCTGGGGCCTCGGGGCCCGGGG + Intronic
1077204936 11:1337494-1337516 CGCCCCCGCCTCGGGCCCCCGGG - Intergenic
1077497393 11:2892734-2892756 GGCTGTCACCTAGGGGCTCCGGG - Intronic
1078176558 11:8976026-8976048 CACTGCAGCCTCTGAGCTCCTGG + Intergenic
1079163350 11:18013695-18013717 CGGGGCAGCCTCGGCGCTCCGGG + Intergenic
1079451177 11:20601166-20601188 CGCCGCCGCCTCCGGGCTGTTGG - Exonic
1081636757 11:44726968-44726990 CGCCGGCGTCGCGGGGCTCCAGG + Intronic
1081989201 11:47328579-47328601 CGCTGCCGCCTGGGGGAGCATGG + Intronic
1083457108 11:62786686-62786708 CGCTGCCGCCAGGGGGCGCGGGG + Exonic
1083596257 11:63919425-63919447 CCCTGCCGCCCCGGGGCTGCGGG + Intergenic
1083871946 11:65493933-65493955 CACTGCGGCCTCTGGGCTCCAGG + Intergenic
1084296215 11:68214421-68214443 CGATCCCTCCTCGGGGATCCCGG + Intergenic
1084304435 11:68272226-68272248 CGCTGCCGTCTTGGGGTCCCGGG + Intergenic
1085052873 11:73388795-73388817 TGCTGATGCCTCGGGGCACCTGG + Intronic
1085718026 11:78890083-78890105 TACTGCCGCCTCTGGCCTCCAGG - Intronic
1088561338 11:111119156-111119178 CACTGCAGCCTCGATGCTCCCGG - Intergenic
1088663810 11:112074413-112074435 CCCAGCGGCCTCGGAGCTCCCGG - Exonic
1091700170 12:2653908-2653930 GGCTCCCACCACGGGGCTCCTGG + Intronic
1091977658 12:4838318-4838340 GCCTGCAGCCTCGTGGCTCCTGG + Intronic
1095099265 12:38163611-38163633 CTCGGCCGGCTCGGGGATCCCGG - Intergenic
1095271461 12:40224618-40224640 CGCCTCCGCTGCGGGGCTCCGGG + Intronic
1096077759 12:48815630-48815652 TGCTCCCGCCTCGGAGCCCCTGG + Intronic
1096250067 12:50025299-50025321 CGTGGCCGCCGCGGGGGTCCGGG - Intronic
1096738862 12:53677180-53677202 CGCCGCCCCCTCCCGGCTCCCGG + Intronic
1096870335 12:54588631-54588653 CGCTCCCAGCTCGCGGCTCCGGG + Exonic
1096983734 12:55743390-55743412 CGCCGCCGCCGCGGGGCCCTCGG - Exonic
1097712961 12:62935007-62935029 TGCAGCCGCCTGGGCGCTCCTGG - Exonic
1103074158 12:117968909-117968931 TGCTGCCGCCGCCGGGCTCCGGG + Intronic
1105349308 13:19601754-19601776 CTTTCCCGCCTCTGGGCTCCCGG - Intergenic
1105389150 13:19959026-19959048 CGCTGCCGCGTCGGGGCCTCGGG + Intronic
1106565863 13:30883984-30884006 CACCGCAGCCTCCGGGCTCCTGG - Intergenic
1107604025 13:42040805-42040827 CGCCGCTGCGCCGGGGCTCCTGG - Intronic
1108227461 13:48303954-48303976 CGCTGCCGCCGCGGAACCCCCGG + Exonic
1108322977 13:49304710-49304732 GGCTGCTGCCTCTGGGCTCTGGG + Intergenic
1108690052 13:52851432-52851454 CGCTGCCGGCCCGGAGCTCACGG - Intergenic
1112291006 13:98143699-98143721 CTCGGGGGCCTCGGGGCTCCGGG + Intronic
1112422837 13:99268530-99268552 CACTGCAGCCTCGGCCCTCCAGG - Intronic
1112561725 13:100521311-100521333 CGCTGCCGGCTCGGGACTTCAGG - Intronic
1113053195 13:106237078-106237100 CACTGCCGCCTCGTGGCTCCAGG + Intergenic
1113082727 13:106535187-106535209 CGCGGCGGACTCGGGGTTCCGGG + Intergenic
1115399006 14:32938274-32938296 CGCTGCCCCCAAGGAGCTCCCGG + Intronic
1115566593 14:34630062-34630084 CGCTGCCCCCACCGCGCTCCCGG + Intronic
1117092989 14:52268667-52268689 CCCTGCTGCCTCGGGGCCCGGGG - Intronic
1117776396 14:59188884-59188906 TGCTGCCTCCCCGGAGCTCCCGG + Intronic
1119303930 14:73591977-73591999 AGCAGCGGCCTGGGGGCTCCAGG - Exonic
1121137207 14:91509895-91509917 CGCGGCCCCCTCGGGGCTGCCGG - Exonic
1122896616 14:104760742-104760764 CGCTGCCCCCTCGGGCCTGTCGG + Intronic
1124914015 15:33950930-33950952 CACTGCAGCCTCAGAGCTCCTGG - Intronic
1128322543 15:66703442-66703464 CGGGGCCGCCGCGGGGCTACCGG - Exonic
1129862542 15:78873501-78873523 CGCAACCACCCCGGGGCTCCAGG - Intronic
1129983712 15:79897291-79897313 CGCTGCCGCCTCCGCGGTCCCGG - Intronic
1131250483 15:90827097-90827119 CGCTTCCTCCTGGGGGTTCCTGG + Intergenic
1132314271 15:100879328-100879350 CGCGCCCGGGTCGGGGCTCCTGG - Intronic
1132469334 16:93173-93195 CCCTTCCCACTCGGGGCTCCAGG + Intronic
1132583259 16:694808-694830 CCCAGCCGCCTCCCGGCTCCGGG - Intronic
1133054849 16:3140779-3140801 CTCAGCCTCCTCGGGGCTCCAGG - Exonic
1133057269 16:3151745-3151767 CACTGCAGCCTCCGGCCTCCCGG - Intergenic
1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG + Exonic
1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG + Intronic
1133802127 16:9092368-9092390 GGCGGCGGCCTCGGGGATCCCGG + Intronic
1134049355 16:11126076-11126098 CGCTGCTGCCCCGGCGCCCCTGG - Exonic
1134290529 16:12900786-12900808 CGGCGCCGCCTCTGCGCTCCCGG - Intergenic
1135392372 16:22104602-22104624 CACTGCAGCCTTGAGGCTCCTGG - Intronic
1136409946 16:30070277-30070299 GGCCGCCTCCTCGGGGCTCCAGG + Exonic
1136453954 16:30370097-30370119 CGCCGCCGCCCCGGGGTTCCCGG - Exonic
1137476051 16:48811000-48811022 CGCGGCCGGCTCGGGCCGCCAGG + Intergenic
1137714817 16:50592229-50592251 TGCCGCCGCCTGGGGGCTGCTGG + Intronic
1137945212 16:52727304-52727326 TGCTGCCTCCTCTGGGTTCCTGG + Intergenic
1138560528 16:57798256-57798278 AGCAGCCTCCTCGGGGCACCAGG + Exonic
1139546705 16:67653113-67653135 CCCTGCCGCCCCTGGGCCCCCGG + Exonic
1139591738 16:67936713-67936735 AGAAGCCCCCTCGGGGCTCCAGG + Exonic
1139615444 16:68085755-68085777 CGCCGCCGCCCCCGGGCTCGCGG + Exonic
1142138300 16:88461361-88461383 GGCTGCACCCTCAGGGCTCCGGG + Intronic
1142177283 16:88651050-88651072 CACTGCCGCCCCTGCGCTCCCGG + Exonic
1142371829 16:89686877-89686899 CGCTGCCGCGCCGAGGCTTCCGG + Intronic
1142852063 17:2709097-2709119 CTCTGCCGCCTTTGAGCTCCCGG - Intronic
1143519395 17:7437023-7437045 CGGTGCCGCCACCGGGCACCAGG - Exonic
1144456938 17:15426539-15426561 TGGTGCCGCCTCTGTGCTCCGGG - Intergenic
1146720442 17:35119848-35119870 CGCTGCCGCTTCCGGGTTCCAGG + Intronic
1146941834 17:36848715-36848737 CACTGCAGCCTCGGAACTCCAGG + Intergenic
1148397733 17:47323819-47323841 CGCCACCGCCCAGGGGCTCCGGG - Intronic
1148899526 17:50865908-50865930 CGCTGCCCCCTCGGCGCCCAGGG + Intronic
1149865936 17:60150947-60150969 CGCAGAGGCCTTGGGGCTCCGGG - Intronic
1150692770 17:67378927-67378949 GGCTGCCGGCTGGGGGCGCCGGG + Intronic
1152521984 17:80862019-80862041 CGCTGCAGCCTCCGTGCTCATGG - Intronic
1152576572 17:81143805-81143827 CCCTGCCTGCCCGGGGCTCCAGG + Intronic
1152654116 17:81512203-81512225 GGATGGCGCCGCGGGGCTCCTGG - Intronic
1152710720 17:81869512-81869534 CCCTGCGGCCGCGGGGGTCCGGG - Intronic
1152720741 17:81922707-81922729 GGCTGGCGCCACGGGGCTGCGGG + Exonic
1155928810 18:31685100-31685122 CGCGGCGGCCGCGGGGCGCCGGG - Intronic
1157095099 18:44680204-44680226 CGCCGCCGCCTCCGCGCGCCCGG + Intronic
1160518196 18:79489891-79489913 CGGTGCCGCTTCGGGGGTCGGGG + Intronic
1160543552 18:79638418-79638440 CGCTGCCCGCTCGGAGCGCCCGG + Intergenic
1160613927 18:80109618-80109640 CGTGGCCGCCTCGGGAATCCCGG + Intronic
1160697342 19:491557-491579 CTCTGACGCCTTGGTGCTCCCGG - Intronic
1160861164 19:1237728-1237750 CGCGGCGGGCTCGGGGCTGCGGG - Intronic
1160864316 19:1250324-1250346 AGCTGCCGGCGCGGGGCCCCCGG + Exonic
1161175899 19:2841919-2841941 CGCTGCGGCTTCGGGACCCCCGG + Intronic
1161317380 19:3623937-3623959 CGCGGCCGCCCGGGGGCTCTGGG + Exonic
1161708208 19:5832185-5832207 CCCTGCCGCCTCGGGGAGCGTGG + Exonic
1161908382 19:7174622-7174644 CGGTGCATCCTCGGAGCTCCTGG + Exonic
1162744205 19:12789897-12789919 CGCTTCTGGCTCGGGGCCCCAGG + Intronic
1163268321 19:16234453-16234475 CACCCCGGCCTCGGGGCTCCTGG + Exonic
1163517945 19:17776088-17776110 CGCTGCTGCCTCGGGGCTGCAGG - Exonic
1163530211 19:17844310-17844332 TGCTGCCCGCTCGGGGCCCCGGG - Exonic
1163691203 19:18739388-18739410 AGCTGCCGCCTGAGGCCTCCTGG + Intronic
1165463554 19:35958935-35958957 GACTGCCTCCTCTGGGCTCCTGG + Intergenic
1166304153 19:41928165-41928187 CTCTGCCTCCCCGGGGCTCCGGG - Intronic
1166883068 19:45940582-45940604 CGCCGCCGCCTCCGGCCTGCTGG - Exonic
1167059068 19:47132035-47132057 CACTGCAGCCTCTGGCCTCCCGG + Intronic
1167074990 19:47243228-47243250 CGCCGCAGCCGCGGGGCTCCGGG + Intergenic
1167171636 19:47836239-47836261 CGCTGCTTCCTGGGGGCGCCTGG - Exonic
1167679631 19:50911338-50911360 CCCGGCCACCTCTGGGCTCCTGG + Intergenic
1167747360 19:51359941-51359963 CGCTGCAGCCTCGACCCTCCTGG - Intronic
1167854088 19:52224358-52224380 GGATGCCTCCTCTGGGCTCCTGG + Intronic
1168280810 19:55304633-55304655 CGCTGCCTTCTCGGGGCCCCAGG + Exonic
1168336282 19:55599408-55599430 CGGGGCCGCCCCGGGTCTCCAGG - Intronic
1168405557 19:56108454-56108476 AGCTGCCTCCTCTGGACTCCAGG + Intronic
925361010 2:3280375-3280397 AGATGCCGCCTCGAGGCACCTGG - Intronic
926329030 2:11809863-11809885 GGCTGCCGCTTCTGGGATCCTGG - Intronic
927083816 2:19655092-19655114 CACTGCCACCCCTGGGCTCCTGG - Intergenic
927702623 2:25277460-25277482 CCCTGACGCGGCGGGGCTCCGGG + Intronic
927714315 2:25342176-25342198 CGCTCCCGCCGCGGCGCCCCGGG - Intronic
927990335 2:27442742-27442764 CTCTGTCGGCTCGGGGCTGCTGG + Exonic
931694176 2:64859724-64859746 GGCTGCCGCCCCAGGGCGCCCGG - Intergenic
932097317 2:68863014-68863036 CGCTGCTGGCTCCGGGCTTCTGG - Intergenic
932180629 2:69643438-69643460 AGCTCCCGGCTCGGGGGTCCCGG - Intronic
932558143 2:72843501-72843523 GGCTGCCCCCTTGGGGCACCTGG - Intergenic
932812279 2:74835056-74835078 CGCTGCCGCGTGGGGCCGCCGGG + Intronic
937304416 2:120862399-120862421 CCTTGCCGTCTGGGGGCTCCAGG + Intronic
937986970 2:127642306-127642328 CGCTGCCGCCTCGGCTCTGCAGG - Intronic
941021030 2:160407917-160407939 CGCTGCCGCCTCCCCGCCCCCGG - Intronic
942027209 2:171922343-171922365 CGCTTCCGCCGCCGGGCTCCTGG + Intronic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
946710172 2:222497367-222497389 CTCTGCCTCCCCGGGTCTCCTGG + Intronic
946966580 2:225042779-225042801 GGCGGCCGCCGAGGGGCTCCGGG + Intergenic
948140476 2:235669506-235669528 CGCCGCCGCCGCCGCGCTCCCGG + Intronic
948889386 2:240899562-240899584 CGCTGCCCCGCCTGGGCTCCAGG + Intergenic
1170567356 20:17614672-17614694 TCCTGCCTCCCCGGGGCTCCCGG + Intronic
1170756949 20:19213022-19213044 CTCCGGCGGCTCGGGGCTCCCGG + Intronic
1171013825 20:21522699-21522721 CCCTCCCGGCTCCGGGCTCCTGG + Intergenic
1171346724 20:24470857-24470879 CGCTGGCGCCGCGGCGCTCCTGG + Intronic
1172640189 20:36436105-36436127 CGCCGCCGCCGCCGGGCACCTGG - Exonic
1173757260 20:45527932-45527954 CACTGTAGCCTAGGGGCTCCTGG + Intergenic
1173985620 20:47259417-47259439 CCCTGCTGCCTCTGGGATCCTGG + Intronic
1176207114 20:63895206-63895228 CGCCGCCGCCCGGGGTCTCCAGG + Exonic
1179476771 21:41651546-41651568 CCCTGCCAGCTCGGGGCTCTGGG + Intergenic
1180221840 21:46364207-46364229 CACTGCGGCCAGGGGGCTCCGGG - Intronic
1180899378 22:19359558-19359580 TGCTGCTGCCTTGGGGCCCCAGG - Intronic
1182086414 22:27564084-27564106 CGTGGCCACCTCAGGGCTCCGGG + Intergenic
1182252771 22:29014717-29014739 CACTGCCCCCATGGGGCTCCTGG + Intronic
1183712646 22:39514535-39514557 CTCTGCCGCCCCCTGGCTCCAGG + Exonic
1184004305 22:41697341-41697363 CGCTGCCGGCCTGGGGGTCCTGG - Exonic
1184273897 22:43399626-43399648 CGCTGCCACCTCCAGGCTCCAGG - Intergenic
1184416206 22:44353132-44353154 AGCTCCCTCCTCGGGGCTCCTGG - Intergenic
1184766949 22:46577127-46577149 CGCCGCCGCCTCCGCGCTCGTGG + Intronic
1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG + Exonic
1185315509 22:50177351-50177373 TGCTGCGGCCGCGGCGCTCCAGG - Exonic
1185397611 22:50600862-50600884 CGCTGTCGCCGCCGGGCTGCAGG + Exonic
1185398526 22:50604480-50604502 CGCGGCCGCCTCGGGGTCCTGGG - Exonic
951627924 3:24686771-24686793 CGCTGGCCACTCTGGGCTCCTGG - Intergenic
961202401 3:125055578-125055600 CGCTCCCGCCTCTGGGGGCCCGG + Exonic
961734603 3:128993645-128993667 CTCTCCCGCCTGGTGGCTCCCGG - Intronic
961827509 3:129606698-129606720 TCCCGCCGCCTCCGGGCTCCCGG - Exonic
964749174 3:160038947-160038969 CTCTGTCGCTGCGGGGCTCCAGG + Intergenic
965590583 3:170357471-170357493 CGCCGCCACTTCGCGGCTCCCGG - Intergenic
965796860 3:172448831-172448853 CGCTCCCGCTTCGCGGCGCCTGG - Intergenic
966113555 3:176432926-176432948 CTCTGCCACTTAGGGGCTCCTGG - Intergenic
966182282 3:177197821-177197843 CGAAGGCGCCTCGGGGCCCCGGG + Intergenic
966860656 3:184229644-184229666 TGGTGCCGCCTCTGCGCTCCGGG - Intronic
966982603 3:185152527-185152549 CTCTGCGGCCGCGGGGCTCCGGG - Intronic
968610254 4:1553837-1553859 CGCACCCACCACGGGGCTCCTGG + Intergenic
968756420 4:2418461-2418483 CGCCGCCCGCTCGGCGCTCCGGG - Exonic
968907797 4:3462708-3462730 CAGTGCCGCCTCAGGGCCCCAGG - Intergenic
969053427 4:4387603-4387625 GGCTGCAGCCTCGGAGCTCCCGG + Exonic
969405222 4:6987144-6987166 CGCTGCCGGCTCGGCGCGTCAGG - Intronic
969640254 4:8393888-8393910 CGCTCCCTCCTCAGGCCTCCAGG + Intronic
969715870 4:8867842-8867864 CGCAGCCGCCGCTGGGCCCCCGG - Exonic
970202880 4:13627489-13627511 CGCCGCCGCCGCCGGGCCCCGGG - Exonic
970560118 4:17274404-17274426 CACTGCAGCCTCAGTGCTCCTGG - Intergenic
971757558 4:30721971-30721993 TGCCGCCGCCTCCGGGCTCCTGG - Exonic
972620601 4:40744894-40744916 CACTGTGGCCTCGGGACTCCTGG + Intergenic
972675596 4:41257163-41257185 CGCCCCCGCCTCGGCGCTCGCGG - Intronic
975336565 4:73183527-73183549 CACTGCAGCCTCTGGCCTCCTGG + Intronic
975541271 4:75514445-75514467 CGCTTCCGCCTCGTAGCCCCGGG - Exonic
975741919 4:77437460-77437482 AGCTGCCTCCTGGGGGCTCTTGG + Intergenic
977908146 4:102501132-102501154 CGGGGCCGCTTCGGGGCGCCGGG - Intergenic
981782376 4:148443714-148443736 AGCTGCCGCCGCCGGGCTGCGGG - Intronic
982198115 4:152936230-152936252 AGCTGCGGCCTCGCTGCTCCTGG - Intergenic
982460970 4:155667857-155667879 CCCTGCTGCCTCCGGGGTCCAGG - Intronic
982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG + Intergenic
983077511 4:163343962-163343984 CGCTGCAGGCCCTGGGCTCCCGG - Intronic
984973588 4:185210431-185210453 CGCGGCGGGCTCCGGGCTCCGGG + Intronic
985410576 4:189679495-189679517 GGCTGCCCCCTCTGGGCTGCTGG - Intergenic
985682973 5:1266094-1266116 GGCTGCCGCCTCGGCCCTGCAGG + Intronic
985933991 5:3080531-3080553 GCCTGCAGCCTCCGGGCTCCTGG - Intergenic
986293951 5:6422202-6422224 CTCTGGCGTCTGGGGGCTCCCGG - Intergenic
986605271 5:9516788-9516810 CGCTGCCCCCATGTGGCTCCAGG - Intronic
986858923 5:11904129-11904151 TGCGGGCTCCTCGGGGCTCCGGG + Intergenic
989011376 5:36876592-36876614 AGCTGCCGCCTCCCGGCTGCTGG + Intergenic
989261580 5:39424847-39424869 CGCTGTAGCCTGGAGGCTCCGGG - Exonic
990852729 5:60225102-60225124 CGCTGCCTCCTCAGGGATCTCGG + Intronic
991263455 5:64690697-64690719 CGCTGCCCCCTCGCCGCGCCGGG - Exonic
992550137 5:77851982-77852004 CGCTCCCGGCTCCCGGCTCCCGG + Intronic
998265474 5:140664807-140664829 CGCTTCCGCCTCGGGGGGCGGGG - Exonic
999252305 5:150190173-150190195 CGCTGCCGTCTGGCGGCTGCGGG - Exonic
999322650 5:150624850-150624872 CGCCGCCGCCTCGGCACACCTGG - Intronic
1002424523 5:179167342-179167364 CGCGGCCGCACCCGGGCTCCCGG + Intronic
1002457604 5:179354432-179354454 CACTCTCGCCTCTGGGCTCCTGG - Intergenic
1004690462 6:17988063-17988085 TGCTGCCGTCCCGGGGCTCCGGG - Intergenic
1005987694 6:30884597-30884619 CGCTCCCGGCTCCCGGCTCCTGG + Intronic
1007275226 6:40668436-40668458 AGCTTCAGCCGCGGGGCTCCAGG - Intergenic
1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG + Intergenic
1013272687 6:108558636-108558658 CCCAGCCGCCTCCGGGCTCCGGG - Intergenic
1013619352 6:111873082-111873104 CGCCGCCCCCTCGGTGCTCTCGG - Exonic
1013883521 6:114933877-114933899 CACTGCAGCCCCGGGGCTCTGGG + Intergenic
1014079543 6:117270883-117270905 GCCAGCCGCCTCGGGGCGCCCGG + Exonic
1018621198 6:165731148-165731170 CCCTGCGGCCTCGTGGCCCCCGG + Intronic
1019088295 6:169502082-169502104 GGCAGCCGCCCCGGGGCTGCGGG + Intronic
1019279265 7:192148-192170 CGCAGACGCCCCGCGGCTCCGGG + Intergenic
1019283048 7:210191-210213 CGCTGCCCCCACGGGTCTCACGG + Intronic
1019435474 7:1020240-1020262 CGCTGCAGCCTCTGCCCTCCTGG + Intronic
1019508874 7:1407299-1407321 CACTGCAGCCTCCGTGCTCCCGG + Intergenic
1023418042 7:39950434-39950456 CGCAGCAGCCTCCGGGCCCCAGG - Exonic
1023881785 7:44325106-44325128 GGCTGCCGGGCCGGGGCTCCGGG - Intronic
1026672676 7:72403359-72403381 GGCAGCCGCATCGGGGGTCCAGG + Exonic
1029713782 7:102314639-102314661 CGCTGCCGCCCGGGGATTCCAGG - Exonic
1029927012 7:104328809-104328831 CGCCGCCGCCGCGATGCTCCCGG + Exonic
1033324891 7:140369170-140369192 CGCTGCCTCCTGAGGTCTCCCGG + Intronic
1033333831 7:140435730-140435752 CGCTGCGGCCTGTGGGCCCCAGG - Intergenic
1034306284 7:150047674-150047696 CGCCGCCGCCGCCGCGCTCCCGG + Intergenic
1034522669 7:151632440-151632462 CGCTGCCGCCCTCGAGCTCCCGG - Intronic
1034800563 7:154052979-154053001 CGCCGCCGCCGCCGCGCTCCCGG - Intronic
1036794949 8:11749100-11749122 CGCAGCCTCCTCTGGGCACCTGG + Intronic
1037582316 8:20252985-20253007 TGTTGCCGCCTTTGGGCTCCGGG + Exonic
1042217075 8:66437840-66437862 CTCTGCAGCCTCGGGCCTCAGGG + Intronic
1046731126 8:117727520-117727542 TGCTGCAGCCTCAGGGCTCCTGG + Intergenic
1049396371 8:142402997-142403019 CGCGGCCCCCGCCGGGCTCCGGG + Intronic
1049406211 8:142452824-142452846 CGGGGACGCCGCGGGGCTCCAGG + Intronic
1049479634 8:142815714-142815736 CCCTGCTGCCTCTGGCCTCCTGG + Intergenic
1049988128 9:970876-970898 CGCCGCCGCCCCGGGGCCCTTGG + Intergenic
1051171572 9:14322712-14322734 CGCTCCCGCCTCCCGGGTCCCGG - Intronic
1053122183 9:35555603-35555625 GCTTGCCGCCTCTGGGCTCCTGG + Exonic
1054731526 9:68705992-68706014 CACTGCGGCCCCGGGGATCCGGG - Intronic
1057312090 9:93949022-93949044 GGCTGCGGCCCCCGGGCTCCGGG + Intergenic
1057432080 9:95004463-95004485 CAGTGGCCCCTCGGGGCTCCGGG - Intronic
1057548069 9:96032683-96032705 CTCTGCCAGCTCCGGGCTCCTGG - Intergenic
1057869833 9:98709103-98709125 GGCTGCCGCCTAGCAGCTCCCGG - Exonic
1059769854 9:117414887-117414909 CGGCCCCGGCTCGGGGCTCCGGG - Exonic
1060358348 9:122931481-122931503 CTCCGGCCCCTCGGGGCTCCGGG + Exonic
1061805641 9:133136292-133136314 CGCTGCCCCCTCAGCCCTCCTGG - Intronic
1062022491 9:134326142-134326164 CGCCGCCTCCTCGCGGCTCCCGG + Intronic
1062216320 9:135391583-135391605 CACTCCTGCCTCGGGGCGCCGGG + Intergenic
1062309494 9:135928463-135928485 CGCTGCGGCCACAGGGCTCATGG + Intergenic
1062341574 9:136095760-136095782 CGGTGCAGCCTCCGGGATCCGGG + Intergenic
1062435968 9:136546682-136546704 GGCTGCTCCCTCGGGGCGCCCGG - Intergenic
1062627002 9:137447938-137447960 CCCTGCCGCCTGAGGGCACCAGG - Exonic
1062648768 9:137564830-137564852 CGCTGTCCCCGGGGGGCTCCTGG - Intronic
1203672186 Un_KI270755v1:25931-25953 GGCTGCCCCCTCTGGGCTGCCGG + Intergenic
1185747472 X:2584230-2584252 CGGGGCCGGCGCGGGGCTCCGGG - Intergenic
1186637886 X:11426260-11426282 TGGTGTCACCTCGGGGCTCCTGG - Intronic
1187915727 X:24150365-24150387 CGCCGCCGCGCCGGGCCTCCGGG - Intronic
1189075024 X:37905862-37905884 CGCCGCCGCCTGGGGGCATCCGG + Intronic
1189324653 X:40105283-40105305 TGCTGCCGCCGCGCGGCTCTCGG - Intronic
1190191348 X:48279812-48279834 CGCTGCAGCCTTGGGACTACAGG + Intergenic
1194600350 X:95913197-95913219 AGCTGCCGCCTGGGGGTTCCTGG + Intergenic
1199793819 X:151177424-151177446 CGCCGCGGCCCTGGGGCTCCAGG + Intronic
1200066102 X:153504760-153504782 CGCTGACACCTCGGGCGTCCTGG + Exonic